ID: 940150253

View in Genome Browser
Species Human (GRCh38)
Location 2:150592226-150592248
Sequence ACCAAAAATGTCTGGAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940150245_940150253 -2 Left 940150245 2:150592205-150592227 CCCCCCATCCCAGTTGTGACAAC No data
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data
940150247_940150253 -4 Left 940150247 2:150592207-150592229 CCCCATCCCAGTTGTGACAACCA No data
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data
940150248_940150253 -5 Left 940150248 2:150592208-150592230 CCCATCCCAGTTGTGACAACCAA No data
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data
940150244_940150253 1 Left 940150244 2:150592202-150592224 CCACCCCCCATCCCAGTTGTGAC No data
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data
940150246_940150253 -3 Left 940150246 2:150592206-150592228 CCCCCATCCCAGTTGTGACAACC No data
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data
940150241_940150253 11 Left 940150241 2:150592192-150592214 CCACTGCCTCCCACCCCCCATCC No data
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data
940150250_940150253 -10 Left 940150250 2:150592213-150592235 CCCAGTTGTGACAACCAAAAATG 0: 118
1: 457
2: 747
3: 1040
4: 1140
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data
940150240_940150253 21 Left 940150240 2:150592182-150592204 CCGGTAGTCTCCACTGCCTCCCA No data
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data
940150242_940150253 5 Left 940150242 2:150592198-150592220 CCTCCCACCCCCCATCCCAGTTG No data
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data
940150243_940150253 2 Left 940150243 2:150592201-150592223 CCCACCCCCCATCCCAGTTGTGA No data
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data
940150249_940150253 -6 Left 940150249 2:150592209-150592231 CCATCCCAGTTGTGACAACCAAA No data
Right 940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940150253 Original CRISPR ACCAAAAATGTCTGGAGACA TGG Intergenic
No off target data available for this crispr