ID: 940154697

View in Genome Browser
Species Human (GRCh38)
Location 2:150643197-150643219
Sequence GTGTGCTGGGGGAGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940154697_940154705 -7 Left 940154697 2:150643197-150643219 CCCTCCATCCTCCCCCAGCACAC No data
Right 940154705 2:150643213-150643235 AGCACACACACCGTCTAGAATGG No data
940154697_940154707 17 Left 940154697 2:150643197-150643219 CCCTCCATCCTCCCCCAGCACAC No data
Right 940154707 2:150643237-150643259 TCTCTGCCCAGCGTCGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940154697 Original CRISPR GTGTGCTGGGGGAGGATGGA GGG (reversed) Intergenic
No off target data available for this crispr