ID: 940158288

View in Genome Browser
Species Human (GRCh38)
Location 2:150682557-150682579
Sequence GGGGGCTCAAAAAAGTTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940158283_940158288 4 Left 940158283 2:150682530-150682552 CCTGTGTTTGTTTTGGTGGAAAG No data
Right 940158288 2:150682557-150682579 GGGGGCTCAAAAAAGTTAGCAGG No data
940158281_940158288 9 Left 940158281 2:150682525-150682547 CCTATCCTGTGTTTGTTTTGGTG No data
Right 940158288 2:150682557-150682579 GGGGGCTCAAAAAAGTTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940158288 Original CRISPR GGGGGCTCAAAAAAGTTAGC AGG Intergenic