ID: 940159238

View in Genome Browser
Species Human (GRCh38)
Location 2:150693648-150693670
Sequence ATTGGTTAAGGGCCATCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940159238_940159249 26 Left 940159238 2:150693648-150693670 CCCAAGGATGGCCCTTAACCAAT No data
Right 940159249 2:150693697-150693719 CCTCAACCCCTTGACCTGGGTGG No data
940159238_940159246 22 Left 940159238 2:150693648-150693670 CCCAAGGATGGCCCTTAACCAAT No data
Right 940159246 2:150693693-150693715 AAAACCTCAACCCCTTGACCTGG No data
940159238_940159243 -7 Left 940159238 2:150693648-150693670 CCCAAGGATGGCCCTTAACCAAT No data
Right 940159243 2:150693664-150693686 AACCAATGACTCCTAAGTATGGG No data
940159238_940159247 23 Left 940159238 2:150693648-150693670 CCCAAGGATGGCCCTTAACCAAT No data
Right 940159247 2:150693694-150693716 AAACCTCAACCCCTTGACCTGGG No data
940159238_940159242 -8 Left 940159238 2:150693648-150693670 CCCAAGGATGGCCCTTAACCAAT No data
Right 940159242 2:150693663-150693685 TAACCAATGACTCCTAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940159238 Original CRISPR ATTGGTTAAGGGCCATCCTT GGG (reversed) Intergenic
No off target data available for this crispr