ID: 940171315

View in Genome Browser
Species Human (GRCh38)
Location 2:150832741-150832763
Sequence AGTTATCTGCAGAAGTTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940171314_940171315 4 Left 940171314 2:150832714-150832736 CCAAGAGCTGTATCTCAAAAGGA No data
Right 940171315 2:150832741-150832763 AGTTATCTGCAGAAGTTGATAGG No data
940171310_940171315 25 Left 940171310 2:150832693-150832715 CCACCAAAGCCTAGTAACAGGCC No data
Right 940171315 2:150832741-150832763 AGTTATCTGCAGAAGTTGATAGG No data
940171312_940171315 16 Left 940171312 2:150832702-150832724 CCTAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 940171315 2:150832741-150832763 AGTTATCTGCAGAAGTTGATAGG No data
940171311_940171315 22 Left 940171311 2:150832696-150832718 CCAAAGCCTAGTAACAGGCCAAG No data
Right 940171315 2:150832741-150832763 AGTTATCTGCAGAAGTTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940171315 Original CRISPR AGTTATCTGCAGAAGTTGAT AGG Intergenic
No off target data available for this crispr