ID: 940171769

View in Genome Browser
Species Human (GRCh38)
Location 2:150836269-150836291
Sequence GCTGCTAGGAAATATAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940171769_940171773 9 Left 940171769 2:150836269-150836291 CCTGCTTTATATTTCCTAGCAGC No data
Right 940171773 2:150836301-150836323 TTTGCTCACCAGATTTAGGGTGG No data
940171769_940171771 5 Left 940171769 2:150836269-150836291 CCTGCTTTATATTTCCTAGCAGC No data
Right 940171771 2:150836297-150836319 AGATTTTGCTCACCAGATTTAGG No data
940171769_940171774 10 Left 940171769 2:150836269-150836291 CCTGCTTTATATTTCCTAGCAGC No data
Right 940171774 2:150836302-150836324 TTGCTCACCAGATTTAGGGTGGG No data
940171769_940171772 6 Left 940171769 2:150836269-150836291 CCTGCTTTATATTTCCTAGCAGC No data
Right 940171772 2:150836298-150836320 GATTTTGCTCACCAGATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940171769 Original CRISPR GCTGCTAGGAAATATAAAGC AGG (reversed) Intergenic
No off target data available for this crispr