ID: 940176481

View in Genome Browser
Species Human (GRCh38)
Location 2:150882877-150882899
Sequence GTCTCATAGGAATCATACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940176477_940176481 8 Left 940176477 2:150882846-150882868 CCTTTTCAAATGTCTTTCTCCAA No data
Right 940176481 2:150882877-150882899 GTCTCATAGGAATCATACTTGGG No data
940176476_940176481 9 Left 940176476 2:150882845-150882867 CCCTTTTCAAATGTCTTTCTCCA No data
Right 940176481 2:150882877-150882899 GTCTCATAGGAATCATACTTGGG No data
940176475_940176481 20 Left 940176475 2:150882834-150882856 CCACTGACAAGCCCTTTTCAAAT No data
Right 940176481 2:150882877-150882899 GTCTCATAGGAATCATACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940176481 Original CRISPR GTCTCATAGGAATCATACTT GGG Intergenic
No off target data available for this crispr