ID: 940179901

View in Genome Browser
Species Human (GRCh38)
Location 2:150920218-150920240
Sequence TCTCCACTGATTTCAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940179893_940179901 3 Left 940179893 2:150920192-150920214 CCTGGATGTGATCATTACCCCTG No data
Right 940179901 2:150920218-150920240 TCTCCACTGATTTCAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940179901 Original CRISPR TCTCCACTGATTTCAGTGGG GGG Intergenic
No off target data available for this crispr