ID: 940181979

View in Genome Browser
Species Human (GRCh38)
Location 2:150944179-150944201
Sequence ATTCGTAATTTTTTTTGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940181979_940181980 9 Left 940181979 2:150944179-150944201 CCGTCTCAAAAAAAATTACGAAT No data
Right 940181980 2:150944211-150944233 ATGAAGTACATGCAGAACCCAGG No data
940181979_940181981 10 Left 940181979 2:150944179-150944201 CCGTCTCAAAAAAAATTACGAAT No data
Right 940181981 2:150944212-150944234 TGAAGTACATGCAGAACCCAGGG No data
940181979_940181982 11 Left 940181979 2:150944179-150944201 CCGTCTCAAAAAAAATTACGAAT No data
Right 940181982 2:150944213-150944235 GAAGTACATGCAGAACCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940181979 Original CRISPR ATTCGTAATTTTTTTTGAGA CGG (reversed) Intergenic
No off target data available for this crispr