ID: 940181981

View in Genome Browser
Species Human (GRCh38)
Location 2:150944212-150944234
Sequence TGAAGTACATGCAGAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940181979_940181981 10 Left 940181979 2:150944179-150944201 CCGTCTCAAAAAAAATTACGAAT No data
Right 940181981 2:150944212-150944234 TGAAGTACATGCAGAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940181981 Original CRISPR TGAAGTACATGCAGAACCCA GGG Intergenic
No off target data available for this crispr