ID: 940184332

View in Genome Browser
Species Human (GRCh38)
Location 2:150966463-150966485
Sequence TACAGCTACTTACTTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940184332_940184336 -7 Left 940184332 2:150966463-150966485 CCCCCATTAAGTAAGTAGCTGTA No data
Right 940184336 2:150966479-150966501 AGCTGTAAGTTTTTTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940184332 Original CRISPR TACAGCTACTTACTTAATGG GGG (reversed) Intergenic
No off target data available for this crispr