ID: 940185430

View in Genome Browser
Species Human (GRCh38)
Location 2:150979677-150979699
Sequence TGTTAACCAAAGCACTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940185430_940185434 2 Left 940185430 2:150979677-150979699 CCCCAAAAGTGCTTTGGTTAACA No data
Right 940185434 2:150979702-150979724 AACAATGGAAGCAGTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940185430 Original CRISPR TGTTAACCAAAGCACTTTTG GGG (reversed) Intergenic
No off target data available for this crispr