ID: 940185434

View in Genome Browser
Species Human (GRCh38)
Location 2:150979702-150979724
Sequence AACAATGGAAGCAGTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940185432_940185434 0 Left 940185432 2:150979679-150979701 CCAAAAGTGCTTTGGTTAACAGT No data
Right 940185434 2:150979702-150979724 AACAATGGAAGCAGTGATGCTGG No data
940185431_940185434 1 Left 940185431 2:150979678-150979700 CCCAAAAGTGCTTTGGTTAACAG No data
Right 940185434 2:150979702-150979724 AACAATGGAAGCAGTGATGCTGG No data
940185430_940185434 2 Left 940185430 2:150979677-150979699 CCCCAAAAGTGCTTTGGTTAACA No data
Right 940185434 2:150979702-150979724 AACAATGGAAGCAGTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940185434 Original CRISPR AACAATGGAAGCAGTGATGC TGG Intergenic
No off target data available for this crispr