ID: 940189867

View in Genome Browser
Species Human (GRCh38)
Location 2:151029221-151029243
Sequence CAGGACAAGGAAGTGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940189859_940189867 22 Left 940189859 2:151029176-151029198 CCTACACAGTGTGTATTTGGTAG No data
Right 940189867 2:151029221-151029243 CAGGACAAGGAAGTGTGGTCTGG No data
940189864_940189867 -10 Left 940189864 2:151029208-151029230 CCAAGGAGCAGGACAGGACAAGG No data
Right 940189867 2:151029221-151029243 CAGGACAAGGAAGTGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940189867 Original CRISPR CAGGACAAGGAAGTGTGGTC TGG Intronic
No off target data available for this crispr