ID: 940191797

View in Genome Browser
Species Human (GRCh38)
Location 2:151048519-151048541
Sequence GTTAGCAGATATAAAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940191797_940191798 6 Left 940191797 2:151048519-151048541 CCAGCAGTTTTATATCTGCTAAC 0: 1
1: 0
2: 1
3: 13
4: 138
Right 940191798 2:151048548-151048570 AGTGCTTATAAACTTGCAATTGG 0: 1
1: 0
2: 0
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940191797 Original CRISPR GTTAGCAGATATAAAACTGC TGG (reversed) Intronic
909840319 1:80312899-80312921 GGTAGGAGATATAAGACTCCTGG - Intergenic
910364384 1:86448587-86448609 GTTAGCAGATCAAACACTTCGGG - Intronic
911227103 1:95318471-95318493 GCAAGCATATATAAAACTGTAGG + Intergenic
911297040 1:96130465-96130487 TTTAGCAAATAGAAAACTGCTGG + Intergenic
913595997 1:120377746-120377768 GTTAGCAGCTCCAGAACTGCTGG - Intergenic
914091282 1:144501230-144501252 GTTAGCAGCTCCAGAACTGCTGG + Intergenic
914307321 1:146432969-146432991 GTTAGCAGCTCCAGAACTGCTGG - Intergenic
914594785 1:149140162-149140184 GTTAGCAGCTCCAGAACTGCTGG + Intergenic
916528435 1:165632637-165632659 GTTACTATATATAAATCTGCAGG + Intronic
917741645 1:177967119-177967141 GAAAGCAGATAGAAACCTGCAGG - Intronic
919175389 1:194012141-194012163 ATGAGCAGATATAACACTGATGG - Intergenic
919501879 1:198347642-198347664 GTTCTCAGATATTAAACTTCAGG - Intergenic
919963815 1:202500608-202500630 GTTAACAGATATAAAATTACAGG + Intronic
1065261946 10:23932772-23932794 GTTGGCAGATATAAAAGACCTGG + Intronic
1067291208 10:44943095-44943117 GTAAGAAGATATAAAATTACTGG - Intergenic
1067917429 10:50415845-50415867 CTTAGCATATAAAATACTGCAGG + Intronic
1068502006 10:57851465-57851487 GTTATCAGAAATAAAACTGCTGG - Intergenic
1070028865 10:72657636-72657658 TTTAGGAGATATAAATATGCAGG - Intergenic
1072662687 10:97372356-97372378 GTTAGCAGGTGTAAAACACCAGG - Intronic
1077400410 11:2353236-2353258 GGAAGCAGATTTCAAACTGCTGG - Intergenic
1079514502 11:21251091-21251113 ATTATCAGATATAAAAATGGAGG + Intronic
1081018180 11:37908238-37908260 ATGAGCAGATATAACACTGGGGG + Intergenic
1082204361 11:49414322-49414344 GGTAGCAGATAGAAAAGGGCAGG - Intergenic
1085059886 11:73435632-73435654 ATTAACAGTTATAAAACTCCTGG - Intronic
1085924874 11:81005274-81005296 GTAAGCATATCTAAAACTTCTGG + Intergenic
1086178534 11:83921496-83921518 GTTGGTACATATAAAACTTCTGG + Intronic
1088443055 11:109893013-109893035 GATAGCTGCTATAAAAATGCAGG - Intergenic
1090247847 11:125229469-125229491 GTTGGCAGATATAAAAACACTGG + Intronic
1091139569 11:133223480-133223502 GGTAGCAGAGAAAAAACTGGAGG + Intronic
1091254908 11:134174619-134174641 ATTAGCACATATAAAATTACAGG + Intronic
1093224136 12:16460651-16460673 GTTAGAAGTTATTAAACTGGAGG - Intronic
1094436129 12:30422735-30422757 GTTTTCAGAAATAAAAGTGCTGG + Intergenic
1095862900 12:46938878-46938900 ATTACTAGATATAAAAATGCTGG - Intergenic
1100419016 12:94411696-94411718 TTTAGAAGAAATGAAACTGCAGG - Exonic
1101316854 12:103636647-103636669 GGTAGAAGATACAAAACTTCTGG - Intronic
1103163351 12:118749576-118749598 GGTAACAGATATACAACTGGGGG - Intergenic
1105847304 13:24304453-24304475 GTTAGAAAAAAAAAAACTGCAGG - Exonic
1108159631 13:47624945-47624967 GTTAATAGATATAACACTGGGGG - Intergenic
1109585221 13:64392467-64392489 GTTAGAGGATAGAAAACAGCAGG + Intergenic
1109595979 13:64554146-64554168 GTTCACAGATATTAAACTGTCGG + Intergenic
1111452091 13:88432762-88432784 ATTAGCAGATATAATACTGAGGG - Intergenic
1113442970 13:110343628-110343650 GTTTGCAAAGATAAAGCTGCAGG + Intronic
1113561347 13:111283905-111283927 CCTAGCAAATATAAAAATGCCGG - Intronic
1115663496 14:35521570-35521592 GTTATCAGATACAAATCTTCAGG + Intergenic
1116410278 14:44612960-44612982 GTTTGCAGATAAGAGACTGCAGG + Intergenic
1117315765 14:54568951-54568973 GCTAGCAAATAGGAAACTGCTGG - Intronic
1120725704 14:87937823-87937845 GTTTGCAAAAATAAAACTGAAGG + Intronic
1125419393 15:39489004-39489026 GTTGGCAGACAGAATACTGCTGG - Intergenic
1131769917 15:95726207-95726229 TATAACAGATATAAAAGTGCTGG - Intergenic
1132174762 15:99702856-99702878 GCTAGCAGTTATAAAACAACAGG - Intronic
1134806821 16:17133061-17133083 GTAAGCAGAGTTTAAACTGCAGG + Intronic
1137234606 16:46605263-46605285 GTTAACAGATATAAAATTAATGG + Intronic
1138696777 16:58821167-58821189 CTTAGCCTACATAAAACTGCAGG - Intergenic
1140581728 16:76238774-76238796 TTTATCAGATATTAAAATGCAGG - Intergenic
1143017526 17:3898805-3898827 GTTATTAGAAGTAAAACTGCTGG + Intronic
1144627350 17:16850975-16850997 GTTAGCAAATGTTAATCTGCTGG + Intergenic
1147581485 17:41629650-41629672 GTTAGCAAATGTTAATCTGCTGG + Intergenic
1147788093 17:42994737-42994759 CTTAGCAGATATCTGACTGCAGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1154257899 18:12800606-12800628 GTTAGCATTTATAAAATTTCAGG + Intronic
1156699886 18:39813530-39813552 TTTATCAGATATAAAATTCCAGG + Intergenic
1157110378 18:44815047-44815069 GTGAGAAGATATATAGCTGCTGG + Intronic
1158891415 18:61875652-61875674 GGTAACGGATATAAAATTGCAGG - Intronic
1160350948 18:78177793-78177815 GCTAGCAGACAGAAGACTGCTGG - Intergenic
925564312 2:5233863-5233885 GTTTCCAGAAATAAAACTCCAGG + Intergenic
925600051 2:5598933-5598955 GTTTGATCATATAAAACTGCTGG - Intergenic
925604680 2:5647093-5647115 GTTAGCAGCTCCAGAACTGCTGG - Intergenic
927022448 2:19031153-19031175 ATAAGCATATATAAATCTGCTGG + Intergenic
929702941 2:44180433-44180455 ATCAGCAGAAATAAAATTGCTGG + Intronic
932493708 2:72136462-72136484 GTTTGCAGAAATAACAGTGCTGG + Intronic
933144737 2:78837821-78837843 TCAAGCATATATAAAACTGCAGG + Intergenic
937493669 2:122395711-122395733 ACTAGCAAATATAAAACTACTGG + Intergenic
939025941 2:137013946-137013968 GTTGGCAGATATAAAACAGGTGG + Intronic
940191797 2:151048519-151048541 GTTAGCAGATATAAAACTGCTGG - Intronic
943323054 2:186469780-186469802 GTTAAAAGAAAAAAAACTGCAGG + Intergenic
943689921 2:190859249-190859271 GTTAAAAGATAAAAAACTGACGG - Intergenic
945398431 2:209350235-209350257 GTTAACAAAAATAAAAATGCAGG + Intergenic
1171933959 20:31256170-31256192 GTTTGCAGCTTTAAAACAGCAGG + Intergenic
1172208125 20:33179095-33179117 GTTTCCAGATTTAAGACTGCTGG + Intronic
1173437403 20:43045507-43045529 GTGAGCTGAGATAACACTGCTGG - Intronic
1177337300 21:19747231-19747253 ATTAGTAGCTATAAAACTGAAGG + Intergenic
1177778756 21:25600133-25600155 GTTACCAGATGTAAAAATTCTGG + Intronic
950117111 3:10458268-10458290 GTGAGCAGATGTTAAACAGCAGG - Intronic
951348590 3:21577116-21577138 GTTAACAGATACAAAATTACAGG - Intronic
954654391 3:52185182-52185204 CTTAGCAGACAGAAGACTGCTGG - Intergenic
954885861 3:53873031-53873053 ATTAGGAGATGAAAAACTGCAGG - Exonic
955183003 3:56689389-56689411 GTTGGCAGCTATAAAACTCATGG - Intergenic
959182081 3:102993933-102993955 GTTAGAAAATATAAGACAGCTGG - Intergenic
960326141 3:116298359-116298381 GCCAGCAAATATAAAGCTGCTGG - Intronic
960394172 3:117116083-117116105 GTTAGTAGATATGAAAATGATGG + Intronic
963558183 3:146823891-146823913 GTTAGCTGAACTAAAACTACTGG + Intergenic
963942432 3:151108376-151108398 GTTAGCAGATATAAAAGACCTGG - Intronic
964491063 3:157237008-157237030 GTTAGCAGATATAAACTTCACGG + Intergenic
966949256 3:184801327-184801349 CTTAGCAGATAAAAAAAAGCTGG - Intergenic
967234741 3:187373261-187373283 GTTAGAAGATAGAACACTGATGG + Intergenic
970258332 4:14194417-14194439 ATTATCAGTTATAAAAATGCTGG + Intergenic
972882578 4:43444421-43444443 ATTAGCATCTGTAAAACTGCAGG + Intergenic
973850515 4:54957060-54957082 GTGAACAGATATAACACTTCTGG - Intergenic
974259562 4:59508149-59508171 GTTAGCTGATATTAAATAGCTGG - Intergenic
977281961 4:95051262-95051284 CTTAGCAGAGATAAAAATGTTGG + Intronic
983524961 4:168751337-168751359 GTTAGCATATATTATACTGCCGG - Intronic
983838092 4:172418369-172418391 GTTAGCAGACATAACCCAGCAGG + Intronic
984570696 4:181389215-181389237 TATAGCAGATATAAAACAGTTGG + Intergenic
987227516 5:15858950-15858972 GATATCAGATATAAAAATACTGG - Intronic
988506124 5:31824989-31825011 TTTAGCACATATGGAACTGCAGG - Intronic
993519893 5:88887955-88887977 TCTATCAGATATAAAACTGAAGG - Intronic
996673056 5:126141899-126141921 CTATGAAGATATAAAACTGCTGG - Intergenic
997827310 5:137117883-137117905 GTCAGCAGATATTAATCTTCAGG + Intronic
998586869 5:143436455-143436477 GTTAGCTTCTATAAAACTGCTGG + Intergenic
1001696885 5:173676843-173676865 GTTAGCAGAGATAAAAGTGGAGG + Intergenic
1002766019 6:239656-239678 TTCAGCAGAAATAAAAGTGCTGG - Intergenic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1006912591 6:37573023-37573045 ATTAAAAGAAATAAAACTGCTGG - Intergenic
1007216276 6:40241843-40241865 AGTACCAGATATAAAACAGCAGG - Intergenic
1011144524 6:84198019-84198041 GTTAGTAAATATAAAACTTAAGG - Intronic
1011982303 6:93395911-93395933 GTTAGCACCAATAAAACTGAAGG - Intronic
1012261548 6:97093143-97093165 GTTAGCAGCAATATTACTGCAGG - Intronic
1013902366 6:115172706-115172728 GACAGAAAATATAAAACTGCTGG - Intergenic
1015932078 6:138371254-138371276 TTTTGCATATATAAAACTTCTGG + Intergenic
1016867689 6:148784261-148784283 TTTAGCAGAGAGAAAACTTCAGG - Intronic
1021345421 7:19521421-19521443 ATTAGGAGATATAAAACTGGTGG + Intergenic
1032751056 7:134842038-134842060 GTGAGCAAATAAAAAACAGCAGG - Intronic
1033381720 7:140827197-140827219 GTTAGCAGACTTAAAACAGCAGG - Intronic
1033500905 7:141948337-141948359 GTTATCAGAAATATAAATGCTGG + Intronic
1036100862 8:5783198-5783220 ATTTGCAGATAAAATACTGCAGG - Intergenic
1038453782 8:27658148-27658170 GATAACAGATATAAAAATACTGG + Intronic
1038559463 8:28559008-28559030 GATAACAGATGTAGAACTGCAGG + Intronic
1041611357 8:59853695-59853717 GTTTGAAGATATAAAACTTGGGG - Intergenic
1044901085 8:96945281-96945303 GGAAGCAAATATAAAACTGAGGG + Intronic
1045034143 8:98164459-98164481 GTTAGCTGATGTAAGAATGCAGG - Intergenic
1047401947 8:124555671-124555693 GTGAGGAGATAGAAAACTGCTGG - Intronic
1050359077 9:4811380-4811402 GTTAACAAATATAAAAGTACAGG - Intronic
1052069547 9:24065299-24065321 TTTATCATATATAAAACAGCAGG - Intergenic
1054753835 9:68936840-68936862 GATAGCACATGCAAAACTGCAGG + Intronic
1055664715 9:78541942-78541964 GTAACAAGATATAAAATTGCTGG + Intergenic
1055864811 9:80800336-80800358 GTTAGTAGAGATCACACTGCAGG - Intergenic
1058123354 9:101163771-101163793 GTTAGCAGATGTAAATCTTTTGG + Intronic
1058852126 9:109022890-109022912 GTTAATAGATATAAAATTACAGG - Intronic
1061166888 9:128928119-128928141 ATTAGCAGAAATACAACAGCCGG + Intronic
1061266252 9:129506790-129506812 GTTATAAGAAATAAAACAGCCGG - Intergenic
1186206460 X:7205544-7205566 GTTGGCTGGTATAAAACTGTAGG + Intergenic
1188751672 X:33912426-33912448 GTTAGGAGAAATAAGACAGCTGG + Intergenic
1192271254 X:69581682-69581704 TGTAGAAGATATAAAACTCCTGG - Intergenic
1192981909 X:76353268-76353290 TTTACCAGATATAAAATTACTGG - Intergenic
1194893987 X:99416091-99416113 GATAGCAGAGACAAGACTGCAGG - Intergenic
1196209333 X:112977801-112977823 TTCAGCAGATATAAAACTCTGGG - Intergenic
1199235167 X:145484286-145484308 TTTAGCAGGTATAAAACTATAGG + Intergenic
1199859596 X:151789464-151789486 GCTAGCAGATACCAAACTTCTGG + Intergenic
1200816585 Y:7539503-7539525 GTTAGAAGATACAAAATAGCAGG + Intergenic
1202299463 Y:23396449-23396471 GTTAACAGATATAAAATTACAGG + Intergenic
1202571346 Y:26274149-26274171 GTTAACAGATATAAAATTACAGG - Intergenic