ID: 940199956

View in Genome Browser
Species Human (GRCh38)
Location 2:151139883-151139905
Sequence AGTGAGGGCCGTGAGCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940199956_940199966 17 Left 940199956 2:151139883-151139905 CCCGCAGGCTCACGGCCCTCACT No data
Right 940199966 2:151139923-151139945 CCTCCCTGAATTCCAGCCCCAGG No data
940199956_940199968 19 Left 940199956 2:151139883-151139905 CCCGCAGGCTCACGGCCCTCACT No data
Right 940199968 2:151139925-151139947 TCCCTGAATTCCAGCCCCAGGGG No data
940199956_940199967 18 Left 940199956 2:151139883-151139905 CCCGCAGGCTCACGGCCCTCACT No data
Right 940199967 2:151139924-151139946 CTCCCTGAATTCCAGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940199956 Original CRISPR AGTGAGGGCCGTGAGCCTGC GGG (reversed) Intergenic
No off target data available for this crispr