ID: 940202475

View in Genome Browser
Species Human (GRCh38)
Location 2:151166788-151166810
Sequence CCAGGTCTCCAGCGCTGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940202475_940202484 4 Left 940202475 2:151166788-151166810 CCTATCCAGCGCTGGAGACCTGG No data
Right 940202484 2:151166815-151166837 GCCTCAGCTGACATGACTTGGGG No data
940202475_940202482 2 Left 940202475 2:151166788-151166810 CCTATCCAGCGCTGGAGACCTGG No data
Right 940202482 2:151166813-151166835 AGGCCTCAGCTGACATGACTTGG No data
940202475_940202486 5 Left 940202475 2:151166788-151166810 CCTATCCAGCGCTGGAGACCTGG No data
Right 940202486 2:151166816-151166838 CCTCAGCTGACATGACTTGGGGG No data
940202475_940202483 3 Left 940202475 2:151166788-151166810 CCTATCCAGCGCTGGAGACCTGG No data
Right 940202483 2:151166814-151166836 GGCCTCAGCTGACATGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940202475 Original CRISPR CCAGGTCTCCAGCGCTGGAT AGG (reversed) Intergenic
No off target data available for this crispr