ID: 940203630

View in Genome Browser
Species Human (GRCh38)
Location 2:151178171-151178193
Sequence TTTATGACTTTACAGTTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940203630_940203632 16 Left 940203630 2:151178171-151178193 CCGTCCAACTGTAAAGTCATAAA No data
Right 940203632 2:151178210-151178232 GTCCTCAGAATGCTTTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940203630 Original CRISPR TTTATGACTTTACAGTTGGA CGG (reversed) Intergenic
No off target data available for this crispr