ID: 940203632

View in Genome Browser
Species Human (GRCh38)
Location 2:151178210-151178232
Sequence GTCCTCAGAATGCTTTTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940203630_940203632 16 Left 940203630 2:151178171-151178193 CCGTCCAACTGTAAAGTCATAAA No data
Right 940203632 2:151178210-151178232 GTCCTCAGAATGCTTTTCAATGG No data
940203631_940203632 12 Left 940203631 2:151178175-151178197 CCAACTGTAAAGTCATAAAAGTA No data
Right 940203632 2:151178210-151178232 GTCCTCAGAATGCTTTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940203632 Original CRISPR GTCCTCAGAATGCTTTTCAA TGG Intergenic
No off target data available for this crispr