ID: 940207182

View in Genome Browser
Species Human (GRCh38)
Location 2:151216090-151216112
Sequence CTGATTGAAAAGAGGCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940207175_940207182 20 Left 940207175 2:151216047-151216069 CCAGCTCCAGAAAATCTACATAG No data
Right 940207182 2:151216090-151216112 CTGATTGAAAAGAGGCAGTAGGG No data
940207178_940207182 14 Left 940207178 2:151216053-151216075 CCAGAAAATCTACATAGAAGGGG No data
Right 940207182 2:151216090-151216112 CTGATTGAAAAGAGGCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940207182 Original CRISPR CTGATTGAAAAGAGGCAGTA GGG Intergenic
No off target data available for this crispr