ID: 940207182 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:151216090-151216112 |
| Sequence | CTGATTGAAAAGAGGCAGTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940207175_940207182 | 20 | Left | 940207175 | 2:151216047-151216069 | CCAGCTCCAGAAAATCTACATAG | No data | ||
| Right | 940207182 | 2:151216090-151216112 | CTGATTGAAAAGAGGCAGTAGGG | No data | ||||
| 940207178_940207182 | 14 | Left | 940207178 | 2:151216053-151216075 | CCAGAAAATCTACATAGAAGGGG | No data | ||
| Right | 940207182 | 2:151216090-151216112 | CTGATTGAAAAGAGGCAGTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940207182 | Original CRISPR | CTGATTGAAAAGAGGCAGTA GGG | Intergenic | ||
| No off target data available for this crispr | |||||