ID: 940210431

View in Genome Browser
Species Human (GRCh38)
Location 2:151251219-151251241
Sequence CTGAGTCAGGAGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 573}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940210431_940210435 29 Left 940210431 2:151251219-151251241 CCATCCACTTTCTCCTGACTCAG 0: 1
1: 0
2: 5
3: 40
4: 573
Right 940210435 2:151251271-151251293 AAGATCCACACTTGTGTTTCAGG 0: 1
1: 0
2: 1
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940210431 Original CRISPR CTGAGTCAGGAGAAAGTGGA TGG (reversed) Exonic
900786126 1:4651791-4651813 CTGAGACAGGAGAACCTGGGAGG + Intergenic
900997689 1:6131251-6131273 CAGAGGCAGGAGAGAGTGAAAGG - Intronic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
902189727 1:14753943-14753965 CTGAGACAGGAGTGAGTGAAGGG + Intronic
902407480 1:16192926-16192948 CTGAGGCAGGAAAAAATGCAAGG + Intergenic
903813777 1:26049767-26049789 CTGAGTCTGGAGATGGTGGGAGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903934091 1:26882872-26882894 CTGAGGCAGGAAAAGGAGGAGGG - Intronic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904087102 1:27916848-27916870 CTGAGGCAGGAGAAAGGAGGAGG - Intergenic
904375449 1:30078776-30078798 GTCACTCAGGAGAAAGTGAATGG + Intergenic
904464962 1:30702159-30702181 ATGAGTGATGGGAAAGTGGAGGG - Intergenic
904561112 1:31397830-31397852 CTGAATCTGGAGGAAGTGGGAGG - Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904781093 1:32948958-32948980 CTGTGCCAGGAAAAAGTGAATGG + Intronic
905030238 1:34877475-34877497 CTGAACCAGGAGAAAGAAGAGGG + Intronic
905599317 1:39235394-39235416 CTGAGTCAGGAGAATCAGGCAGG + Intronic
905865750 1:41375689-41375711 CTGGGCCTGGAGAAATTGGATGG + Intronic
906045647 1:42828943-42828965 CAGAGTCACTAGAAAGTTGAGGG + Intronic
906116741 1:43362091-43362113 CTGAGTCTGGAGCATGTGGCAGG + Intronic
906301756 1:44687513-44687535 CTCTGTGAGGAGAAACTGGAGGG + Intronic
907052800 1:51341070-51341092 CTGAGGCAGGAGAACCTGGAAGG + Intronic
907298950 1:53473709-53473731 CTGAGTCAGAATAAATGGGATGG - Intergenic
907474438 1:54695999-54696021 GTGAGTCAGGAGAAGTTGGTGGG + Intronic
908771975 1:67605780-67605802 CTGAGGCAGAGGAAACTGGAGGG + Intergenic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
909502705 1:76353545-76353567 CTGAGACAGGAAACAGTGAAGGG + Intronic
910978520 1:92934580-92934602 CTGAGTCAGCATATACTGGAAGG + Intronic
911135875 1:94439541-94439563 CTGATACAGGAGAACGTGGGAGG + Intronic
911380342 1:97106408-97106430 CTGAGTAAAGAGAATGTGGGCGG + Intronic
912504454 1:110146604-110146626 CTGAGTCAGGAAGGAGTGGGGGG + Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
914893990 1:151652090-151652112 CTGAGTCAGGAGAATCAGGCAGG + Intronic
915208239 1:154287016-154287038 CTGAGGCAGGAGAATCAGGAAGG - Intergenic
915354690 1:155249010-155249032 CTGAGAAAGGAGACAGTGGCCGG - Intronic
915719779 1:157976281-157976303 CTGAGACAGGAGAACCTGGGAGG + Intergenic
916037191 1:160932758-160932780 CTGAGGCAGGAGAAAAAGGCAGG - Intergenic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917670686 1:177270671-177270693 CCAAGTCAGGAGTAAGTGGATGG + Intronic
917840590 1:178974276-178974298 CTCTCTCAGGAGAGAGTGGAGGG + Intergenic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
919517703 1:198547465-198547487 CTGAGTTAGGACACAGTGCAGGG - Intergenic
919967146 1:202539214-202539236 CTGAGGCAGGGGACACTGGAAGG + Intronic
920402005 1:205681786-205681808 CAGAGCCAGGAGAGAGTGGACGG + Intergenic
920513396 1:206567076-206567098 CTGAGTGAGCAGAAAATGCAAGG + Intronic
920903503 1:210136312-210136334 ATGAGTAAGGAGAAAGGGAACGG + Intronic
921667871 1:217894592-217894614 CTGAGGCAGGAGAAACCGGGAGG - Intergenic
922708659 1:227808768-227808790 CTGAGTCATGACATAATGGAAGG - Intergenic
922819766 1:228476264-228476286 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
923793178 1:237128273-237128295 CTGAGTCAGGAGAATCAGGCAGG + Intronic
924102936 1:240622837-240622859 CTGAGTCAGGAGAATCCGGGAGG - Intergenic
924857323 1:247886783-247886805 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1063138855 10:3239299-3239321 CGGGGTCAGGATAAAGGGGAAGG + Intergenic
1063708371 10:8453183-8453205 CTAAGTGAGGTTAAAGTGGAAGG - Intergenic
1063732775 10:8718379-8718401 CTGAGTCAGGGGGAAGTAAAAGG - Intergenic
1063987052 10:11515752-11515774 ATGAGTGAGGACAAAGTTGATGG + Intronic
1064772206 10:18735080-18735102 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1065238130 10:23675832-23675854 CTGAGTCATGAAAAAGTGGTGGG + Intergenic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1066407551 10:35133395-35133417 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1067784137 10:49230128-49230150 TTGAGCCAGGAGAATGGGGAGGG + Intergenic
1069011282 10:63375990-63376012 CTGAGAAAGAAGAAAGTTGACGG + Intronic
1070430997 10:76337500-76337522 CTGAGGAAGGAGCAAGTGCAAGG + Intronic
1070636328 10:78131079-78131101 CTGAGTCACTTGAAAGTGGGTGG + Intergenic
1070835321 10:79444235-79444257 ATGAGGCAGGAGTAAATGGAGGG + Intronic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1071601189 10:86959455-86959477 CTGTGTCTGGAAGAAGTGGATGG - Intronic
1071720424 10:88138509-88138531 CTTAGCCAGCAGAGAGTGGAGGG - Intergenic
1071805928 10:89120878-89120900 CTGAGTCTGGAGAAGCAGGAAGG + Intergenic
1072442805 10:95471764-95471786 CAGTGACAGGAGGAAGTGGAAGG + Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1073446102 10:103581291-103581313 ATGATTCAGAAGAAAGTGCATGG - Intronic
1074702722 10:116106628-116106650 CAGAACCAAGAGAAAGTGGAGGG - Intronic
1075011559 10:118874733-118874755 CTGAAACAGGGGAATGTGGATGG + Intergenic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076199464 10:128546890-128546912 CTGAGCCAGGAGGTAGTAGACGG - Intergenic
1077513594 11:2986714-2986736 CTGAGGCAGGAGAAACTGGGAGG - Intronic
1077719850 11:4617046-4617068 CTGAAACAGGAGGAAGTGGGGGG + Intergenic
1077836926 11:5934113-5934135 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1078240929 11:9530290-9530312 CTGAGCCAGGAAATACTGGACGG - Intergenic
1078401246 11:11029268-11029290 GTGACTCAGAGGAAAGTGGAGGG + Intergenic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1080656849 11:34265038-34265060 CTGAGTCACGAGGAAGTGAGAGG - Intronic
1081928643 11:46852115-46852137 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1082019791 11:47522428-47522450 CTGAGTCAGGAGAACCCGGGAGG + Intronic
1083114831 11:60450792-60450814 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1083118749 11:60491024-60491046 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083154446 11:60814577-60814599 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083380867 11:62267522-62267544 CTGAGACAGGAGAACCTGGGAGG + Intergenic
1083845250 11:65328099-65328121 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1083948692 11:65941566-65941588 CTGATGCAGGAGAGAGTGGGAGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084502029 11:69540553-69540575 GGAAGTAAGGAGAAAGTGGAGGG - Intergenic
1085742774 11:79091040-79091062 GGCAGTCAGGAGAAAGGGGAAGG + Intronic
1086521445 11:87672573-87672595 CTGAGTTTGGAGCAAGTGCAGGG + Intergenic
1086927425 11:92655586-92655608 AAGAGTCAGGAGTAAGTAGATGG - Intronic
1087284402 11:96249056-96249078 CTGAGTCAGGTGAAAGTCATTGG - Intronic
1088261052 11:107944483-107944505 CTGAGACAGGAGAATCTGGGAGG - Intronic
1088474346 11:110219723-110219745 CTGAGGCAGGAGCAAGTTTAAGG + Intronic
1089748647 11:120634713-120634735 CGGAGTCCGGAGACAGTGGGAGG + Intronic
1090300111 11:125628476-125628498 GTGACTCAGGAGAGAGTTGAGGG + Intronic
1090705145 11:129329530-129329552 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1090789004 11:130073740-130073762 CTGAGGCAGGAGAATCTGGGAGG + Intronic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1094816117 12:34186491-34186513 CTGAGCCAGTCGAATGTGGAAGG - Intergenic
1096817705 12:54211759-54211781 CAGAGACAGGAGGAAGTGCAAGG - Intergenic
1096836852 12:54356669-54356691 CCGAGTGAGAAGACAGTGGAAGG + Intergenic
1097726249 12:63078757-63078779 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1098088761 12:66878460-66878482 CTGGGAGAGGAGAAAATGGAGGG + Intergenic
1098543783 12:71688326-71688348 CTGAGGCAGGAGAAACCAGAAGG - Intronic
1098696005 12:73555690-73555712 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099823110 12:87740207-87740229 CTTAGTGAGGAGAAAGTTCAAGG + Intergenic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1100042209 12:90333757-90333779 CTGAGTCATCAGAAAATGGTAGG - Intergenic
1100224600 12:92543247-92543269 CTCAGTCTGGATATAGTGGAAGG - Intergenic
1100511177 12:95275485-95275507 CTGAGGCAGGAGAACCCGGAAGG + Intronic
1101303636 12:103505472-103505494 CTGAGTCATGGGAACGTGGTAGG + Intergenic
1102373719 12:112404132-112404154 CTGAGGCAGGAGAATTTGGACGG - Intergenic
1102511083 12:113415985-113416007 CAGGGGCTGGAGAAAGTGGAGGG - Intronic
1103572581 12:121854892-121854914 CTGGGGCTGGAGAAACTGGAGGG - Intronic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1104808774 12:131607209-131607231 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1105527235 13:21187302-21187324 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1106142131 13:27020309-27020331 CTGAGTGAGGCCAGAGTGGAGGG + Intergenic
1106264447 13:28097729-28097751 ATGATTCAGGAGAAAGTGGAGGG - Intronic
1106668943 13:31884371-31884393 CAGTGTCAGGAGAAAGTTTATGG - Intergenic
1108320971 13:49290163-49290185 CTGAGTGGGGTGAAAGGGGATGG + Intronic
1109282409 13:60372260-60372282 CAGAGACAGGAGAAAGCGGTAGG - Intergenic
1109285403 13:60402785-60402807 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111226984 13:85287718-85287740 GTGAGGCAGGAGAGAGAGGAGGG + Intergenic
1111456143 13:88486831-88486853 TTGAGTTAGAAGAAATTGGAGGG - Intergenic
1112261798 13:97884256-97884278 CAGACTCAGGGGAAAGTGGCTGG + Intergenic
1112373509 13:98816712-98816734 GTTAGTCAGGTGAAAGTGAAAGG + Intronic
1112498989 13:99927839-99927861 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1112805059 13:103155645-103155667 CTGAGTCAGGAAAAACTTCAAGG + Intergenic
1114194137 14:20462014-20462036 CTGAGCGGGGAGAAAATGGACGG + Intergenic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1114658021 14:24327706-24327728 CAGAGACAGGAGGAAGTGGGGGG + Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115703899 14:35978532-35978554 CTGAGGCAGGAGAAACAGGCAGG + Intergenic
1116992016 14:51286682-51286704 CTGAGGCAGGAGTAAAGGGAGGG + Intergenic
1117533946 14:56686614-56686636 CAGAGTCAGGGGAAAGGGCACGG - Intronic
1117689307 14:58289836-58289858 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1118281291 14:64431162-64431184 CTGAGGCAGGAGAACTTGGGAGG - Intronic
1118602702 14:67481775-67481797 CTGAGCAAGGAGCTAGTGGAAGG - Intronic
1118807677 14:69251778-69251800 CTGAGGTAGAAGAAAGAGGAAGG + Intergenic
1119254744 14:73185494-73185516 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1119310894 14:73645271-73645293 CTCAGACAGGAGAAAAGGGAGGG + Intronic
1119356489 14:74011335-74011357 TTGAGTGAGAAGAAAGTGTAGGG - Intronic
1120892724 14:89505371-89505393 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1121067198 14:90979279-90979301 CTAAGGCAGGAAGAAGTGGAAGG + Intronic
1121696639 14:95918680-95918702 CTGACTCAGGAGGAAGTGGAGGG - Intergenic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122131890 14:99609059-99609081 CTGAAGCAGGAGGAAGTGGGTGG - Intergenic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1124939018 15:34200559-34200581 CTGAATTAAGAGAAAGTGGTGGG - Intronic
1125214163 15:37250615-37250637 CTGAGTAAGGAGACAGAAGATGG - Intergenic
1125457982 15:39880063-39880085 CTGAGTCTTGAGAAGGTTGAAGG - Intronic
1125459819 15:39895119-39895141 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1126779408 15:52125763-52125785 CTGGGGCAGGACAAAGTGGGAGG + Intronic
1127371762 15:58348135-58348157 CTGAATCTGGAGAGTGTGGAAGG - Intronic
1127957479 15:63865520-63865542 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1128017577 15:64360790-64360812 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1128674441 15:69598194-69598216 ATGAGAAGGGAGAAAGTGGATGG + Intergenic
1128765188 15:70247049-70247071 CTGAGTCAAAATAAAGAGGAAGG - Intergenic
1128936607 15:71751130-71751152 TTTAGCCTGGAGAAAGTGGAAGG - Intronic
1129179274 15:73862050-73862072 CCAAGTCAGGAGATATTGGAGGG - Intergenic
1129228348 15:74182753-74182775 CAAACTCAGGAGAAACTGGAGGG - Intronic
1130402819 15:83573453-83573475 CTGATTCAGGAGATAAGGGATGG - Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1133219126 16:4311264-4311286 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1134008636 16:10835036-10835058 CTGAGTCAGGAGATGGTTGAAGG - Intergenic
1134762824 16:16729150-16729172 GTGAGCCAGGAGCAAGTGGCAGG - Intergenic
1134795493 16:17031859-17031881 CTGCTGCAGGAGAAAGTGTAAGG - Intergenic
1134983228 16:18629998-18630020 GTGAGCCAGGAGCAAGTGGCAGG + Intergenic
1135240560 16:20803962-20803984 CTTAGTCAGGAGACTGTGGTGGG - Intronic
1135291766 16:21245561-21245583 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1136155035 16:28376825-28376847 CTGAGACAGGAGAATGAGGCAGG - Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1137493331 16:48951203-48951225 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1137518412 16:49170851-49170873 CAGAGCAAGGAGAAAGTTGAAGG - Intergenic
1138079649 16:54077761-54077783 CTGAGTCAGAAGGAAGAGGTAGG + Intronic
1139293513 16:65879081-65879103 CTGAGTCAGGAGAAAGGCATGGG + Intergenic
1139959211 16:70708183-70708205 GTGAGGCAGGAGACAGGGGAGGG - Intronic
1140024101 16:71267886-71267908 CTGCATAAGGAGAAAGTGTAAGG + Intergenic
1140154234 16:72405887-72405909 CTCAGACAGGAGAAAGCTGAGGG + Intergenic
1140664071 16:77212685-77212707 CCGAGTCAGGAGAGAGCGGGCGG + Intronic
1140986049 16:80158958-80158980 CTGGGTCAGGAAAAAGTTGAGGG + Intergenic
1141179169 16:81740633-81740655 CTGAGGCAGGAGAACTTGGGAGG + Intronic
1141490963 16:84372521-84372543 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1141551306 16:84808490-84808512 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1141838628 16:86559862-86559884 ATGAGTGAGGAGAAAGGGGGAGG + Intergenic
1142110108 16:88326813-88326835 CTGAGTCAGGAAAGAGCGGGGGG - Intergenic
1142332175 16:89462176-89462198 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1142533456 17:598068-598090 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1142583194 17:954468-954490 CTGAGCCTGGAGAATTTGGAAGG - Intronic
1143116139 17:4582795-4582817 CTGAGGCTGGAGAGTGTGGATGG + Intergenic
1143337038 17:6179114-6179136 CTACGTCAGCAGAAACTGGAAGG - Intergenic
1143689503 17:8549795-8549817 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1143960964 17:10719364-10719386 CTGAGGCAGGAGAAACCGGGAGG - Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144722895 17:17484610-17484632 CTGAGGGAGAAGAAAGTGAACGG - Intronic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1145104479 17:20103751-20103773 CAGTGCCAGGAGGAAGTGGACGG - Intronic
1145173977 17:20684500-20684522 CTGAGGCAGGAGAATCTGGCAGG - Intergenic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1145920408 17:28605154-28605176 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1146022258 17:29290011-29290033 CTGAGTCAGGAGAATCTGGGAGG - Intronic
1146188638 17:30745756-30745778 CTGAGGCAGGAGAATGCGGGAGG - Intergenic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1146688486 17:34857138-34857160 CTCACCCAGGAGAAGGTGGATGG + Intergenic
1147456392 17:40540880-40540902 CTGAGTTATGAGAAAGTTTAGGG + Intergenic
1147985236 17:44302765-44302787 CTGAGGCAAGAGAATCTGGAAGG + Intergenic
1148114554 17:45167980-45168002 CTGAGGCTGGAGAATGTGGGCGG - Intronic
1148175499 17:45560598-45560620 CTGAGACAGGAGAATCTGGGAGG + Intergenic
1148295872 17:46502398-46502420 CTGAGACAGGAGAATCTGGGAGG - Intergenic
1148587925 17:48794089-48794111 CTGCTCCAGGAGAGAGTGGATGG + Intronic
1148805132 17:50260066-50260088 CTGAGACTGGAGAAGCTGGAGGG - Intergenic
1149409720 17:56393006-56393028 CTAAGGCAGGAAAAAGAGGAAGG - Intronic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1150406716 17:64907542-64907564 CTGAGACAGGAGAATCTGGGAGG + Intronic
1151114831 17:71724075-71724097 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1151452583 17:74207614-74207636 CTGAGGCAGGAGAACATGGGAGG - Intronic
1151645851 17:75431138-75431160 CTGAGGCAGGAGAATGCGGGAGG - Intergenic
1151738458 17:75961668-75961690 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1151821827 17:76500931-76500953 CTCACCCGGGAGAAAGTGGAGGG + Intronic
1152128989 17:78465037-78465059 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1152213140 17:79014326-79014348 CTTAGATAGGAGAAAGCGGAAGG + Intergenic
1152307170 17:79527925-79527947 CTGACTCGGCAGAAAGAGGAAGG - Intergenic
1153488194 18:5623322-5623344 CTGAGTTATGAGAAATTGAATGG - Intronic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153633910 18:7097956-7097978 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1154052095 18:10970722-10970744 GTGAGTCAGGAGAAAGAGGAAGG + Intronic
1155964606 18:32024290-32024312 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156641362 18:39104167-39104189 CTGAGGCTGTTGAAAGTGGAGGG + Intergenic
1157048363 18:44130390-44130412 CTGAATCAGGAAACAGTGGGGGG + Intergenic
1157181986 18:45506232-45506254 CTAAGTGAGGATAAAGTGAAGGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157990717 18:52492485-52492507 TTGAGACAGGAGAAAGAAGAAGG + Intronic
1158140245 18:54247537-54247559 CTGAGTTAGTAGAATCTGGAGGG + Intergenic
1158181396 18:54718632-54718654 TTGAGTCAGGAAAAAGTATATGG - Intronic
1158726184 18:59974979-59975001 CAGAGTCAGTAGAAAGAGAAAGG + Intergenic
1159046519 18:63373986-63374008 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1159340602 18:67127565-67127587 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1161167197 19:2794640-2794662 CTGAGGCAGGAGAGAGTTCACGG + Intronic
1161480578 19:4508363-4508385 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1162283493 19:9719520-9719542 CTGAGGGAAGAGAGAGTGGAAGG - Intergenic
1162396790 19:10421713-10421735 CAGAGGCAGGAAACAGTGGAGGG + Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162629735 19:11917722-11917744 CTGAGCCAGGAGAATCTGGGAGG - Intergenic
1162796808 19:13091317-13091339 CTGAGTCCAGAGAAAGTTGGTGG + Intronic
1162809319 19:13154677-13154699 CTGAATCACGAGAATGTGGAGGG + Exonic
1163905253 19:20146720-20146742 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164389226 19:27803815-27803837 CACAGTCAGGAGAAAGGTGATGG - Intergenic
1164436057 19:28230515-28230537 CTGAGTCACAAGAAAGTGGCTGG + Intergenic
1166155250 19:40906318-40906340 CTGAGGCAGGAGAGAATGGGAGG + Intergenic
1166374741 19:42321312-42321334 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1166822658 19:45590142-45590164 GTGACTCGGGGGAAAGTGGAAGG - Exonic
1167038648 19:47009226-47009248 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1168025976 19:53643837-53643859 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
925067212 2:937793-937815 CTGAGTCAGGAGAGAGTCACGGG + Intergenic
925869249 2:8254914-8254936 CAGAGCCAGGAGAAAGTGAGGGG - Intergenic
925932799 2:8723609-8723631 CTGAGGGAGGAGATAGTAGAGGG + Intergenic
926215697 2:10903756-10903778 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
927002832 2:18816712-18816734 GTGAGGCAGGAGAAAGAGTAGGG + Intergenic
928477848 2:31649333-31649355 ATGTGTCAGGAGCCAGTGGATGG - Intergenic
929003222 2:37368324-37368346 CAGAGTCAGGAGAAGATGCAGGG - Intronic
929066641 2:37982446-37982468 CTCTGTCATGAGAGAGTGGAAGG + Intronic
929075897 2:38078491-38078513 CTGAGCCAGGAGAACCTGGCAGG - Intronic
929249768 2:39739811-39739833 CTGAGCAAGGAAGAAGTGGATGG + Intronic
929464299 2:42130902-42130924 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
930063243 2:47308462-47308484 ATGAGTCAGGAGCTGGTGGAGGG - Intergenic
930774969 2:55162447-55162469 GTGAGTCAGGAGACAGGGGCTGG - Intergenic
931576251 2:63721836-63721858 CTGAGTCAGGAGAATCAGGCAGG - Intronic
932153621 2:69395263-69395285 CTGAGTCAGAAGCCAGTGGGAGG + Intergenic
933747820 2:85583773-85583795 CTGACTGAGGAGCAAGTGCATGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934702016 2:96449985-96450007 CTGAGCAAGGAGATAGTAGATGG - Intergenic
934776958 2:96945370-96945392 CTGAGTAAGGAAAGAGTTGAGGG - Intronic
935402350 2:102673884-102673906 CTGAGGCAGGAGAATGGGCATGG - Intronic
935572002 2:104671478-104671500 CTGAGCCAGGAGACAGAGAAGGG + Intergenic
935620749 2:105127589-105127611 CTAAGTGAGGAAAAAGAGGAAGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935914168 2:107931332-107931354 CTGAGGCAGGAGAAAATGGCAGG - Intergenic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936260734 2:110957958-110957980 CTGAGGCAGGAGAACCTGGGAGG + Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936872839 2:117153959-117153981 TTGAGTCAGGACAAAATGAAAGG - Intergenic
937138962 2:119581624-119581646 TTCTGTCAGGAGAGAGTGGAGGG + Intronic
937479470 2:122243568-122243590 CTGTGTTGGGAGAAAGTAGAAGG - Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938338720 2:130521308-130521330 CTCAGCCAGGAGAAACGGGATGG - Exonic
938351120 2:130599442-130599464 CTCAGCCAGGAGAAACGGGATGG + Exonic
938803713 2:134786969-134786991 CAGAAGCAGGAGAAAGTTGAAGG + Intergenic
938923883 2:136021107-136021129 CTGGGTCAAGAGAATGTGGATGG + Intergenic
939917609 2:148066574-148066596 CTGAGACAGGAAAAACTGGGAGG - Intronic
939989111 2:148860739-148860761 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
940160581 2:150708331-150708353 GTGAGGCAGGAGAAAGGGGAGGG + Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940635434 2:156292969-156292991 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
940891851 2:159042834-159042856 GTGAGGCAGGAGATAGGGGAAGG + Intronic
941652778 2:168111260-168111282 CTTAATCTGAAGAAAGTGGAAGG - Intronic
941934218 2:170970722-170970744 CTGAGTCTGGGGAGAGGGGAGGG + Intergenic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942492026 2:176498992-176499014 CAGAGAGGGGAGAAAGTGGAGGG - Intergenic
942648641 2:178143735-178143757 CTGATGCAGGAGATAGTGGCAGG + Intergenic
942667948 2:178342024-178342046 ATGAGGTAGGAGAAAGTGGTGGG - Intronic
942724944 2:178996174-178996196 CTGAGGCAGGAGAATCTGGGAGG - Intronic
942964845 2:181879506-181879528 CTGGGTGAGGAGAGAGTGGTAGG - Intergenic
943553941 2:189377715-189377737 GTGAAGGAGGAGAAAGTGGAGGG - Intergenic
943794501 2:191975411-191975433 TTGAGTTTGGAGAAAGTTGAGGG - Intronic
943824384 2:192370641-192370663 CTGAGTGAGGAGAACTTTGATGG - Intergenic
944215797 2:197254292-197254314 CTGAGGCAGGAGAACCTGGGAGG + Intronic
944379276 2:199088423-199088445 ATAAGTCAGGAGAAAGGGGAAGG + Intergenic
945041354 2:205746014-205746036 CTGAGGCAGGAGAACATGGCAGG - Intronic
945236375 2:207635536-207635558 CTGAGACAGAAGAAGTTGGAGGG + Intergenic
945930193 2:215847163-215847185 CTGAGTATGGATAAACTGGAAGG + Intergenic
946313889 2:218897288-218897310 CCGAGGCAGCAGAAAGGGGAGGG + Intronic
947155017 2:227153726-227153748 CTGAGGCAGGCCAAAGTGAAGGG + Intronic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1169192554 20:3667389-3667411 CAGAATCAGGAGCGAGTGGAAGG - Intergenic
1169417678 20:5431873-5431895 CTGAGGCATGGGACAGTGGAGGG - Intergenic
1169730293 20:8778545-8778567 CTTAGTGAGAAGGAAGTGGAAGG - Intronic
1170952792 20:20951901-20951923 CTGAGACAAAAGAAAGGGGATGG + Intergenic
1170995482 20:21352425-21352447 CTGAGGCAGGAGAAATTGCTTGG - Intronic
1171470436 20:25366363-25366385 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1171777963 20:29388312-29388334 CAGAGCCAGTAGAATGTGGAGGG - Intergenic
1171996791 20:31737634-31737656 CTGAGGCAGGAGAAACCGGGAGG + Intergenic
1172728732 20:37068945-37068967 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1173154216 20:40594230-40594252 CACAGTCAGGAGGAAGAGGAAGG + Intergenic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1175420208 20:58827269-58827291 ATGAGTCAGGAGAGAGGGCATGG - Intergenic
1175624365 20:60478167-60478189 CTGTGTCAGGAGAGAGAGAAAGG - Intergenic
1177169163 21:17637206-17637228 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1177491252 21:21829068-21829090 CTTAGTCAGGAGGGAGTTGAGGG - Intergenic
1177521783 21:22236136-22236158 CTGAGTCAACAGAACATGGAGGG + Intergenic
1177697658 21:24594209-24594231 CTGATTCAGGAGAACTTGGATGG + Intergenic
1178570880 21:33735904-33735926 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1178729784 21:35090735-35090757 TTGGGTCAGGAAAAAGGGGAAGG - Intronic
1180649638 22:17368011-17368033 CTGTGCCAGGAGAGAGTGGTGGG + Intronic
1181296830 22:21847096-21847118 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1181311194 22:21945882-21945904 CTCAGCCAGGAGGAGGTGGAGGG - Exonic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182497940 22:30723794-30723816 CTGTGTCGGGAGAGAGTAGATGG - Intronic
1182695906 22:32199191-32199213 CCCAGTCAGGAGAGAGGGGAAGG + Intronic
1182774223 22:32819038-32819060 GTGAGCCAGAGGAAAGTGGAGGG + Intronic
1183774285 22:39953148-39953170 CAGAGTCATCAGAAAGTGGGTGG - Intronic
1183886056 22:40883286-40883308 CTGATTCAGTAGATAGGGGATGG - Intronic
1184314531 22:43674465-43674487 CTGGGTCACGAGGAACTGGAAGG + Intronic
1184430150 22:44437799-44437821 ATGAGTCAGGAGAATCTGGAAGG + Intergenic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
1185385736 22:50530663-50530685 CAGAGTCAGGAGAGTGGGGAGGG - Intronic
949538868 3:5016784-5016806 GTGAGTCAGGAGGCAGAGGAGGG + Intergenic
950456992 3:13098635-13098657 CTGAGCTAGGGGAAAATGGATGG + Intergenic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
951877357 3:27441983-27442005 CTGAGGCAGGAGAATCTGGGAGG - Intronic
952064744 3:29555756-29555778 CTGAGTGAGAACAAAGTTGAGGG - Intronic
952740700 3:36731524-36731546 CTGAGTTAGGATAGAATGGAAGG - Intronic
953875157 3:46662453-46662475 GTGAGTCAAGAGAAAGAGGCTGG + Intergenic
954064058 3:48091690-48091712 CTGAAGCAGGAGCAAGGGGAAGG - Intergenic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
955417372 3:58705175-58705197 CTGGGTCATGAGAGAGTGAATGG - Intergenic
955472638 3:59301834-59301856 TTGAATCAGGAGGAAGTGGGAGG + Intergenic
955674710 3:61435617-61435639 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
955857033 3:63283905-63283927 CTGAGGCAGGAGAACCCGGAAGG - Intronic
956212217 3:66813834-66813856 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
956460925 3:69471761-69471783 CTGAGTCAGAAGAGAGTGGATGG - Intronic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
960195170 3:114757460-114757482 CAGAGTTATGAGAAATTGGAAGG - Intronic
960697916 3:120413888-120413910 CTGAGTCAGGAGAATCAGGCAGG - Intronic
960998444 3:123354674-123354696 GTGAGACAGGAGAAACTGGGAGG + Intronic
962159392 3:132982868-132982890 CTGAGGCATGGGAAAATGGAAGG + Intergenic
962779228 3:138695852-138695874 CTGAGGCAGGAGAATCTGGGAGG - Intronic
962941881 3:140132465-140132487 GTGAGGCAGGAGAAAGTACATGG + Intronic
963553003 3:146748095-146748117 TTTAATCAGGAGAAAGTAGAGGG + Intergenic
964780778 3:160335318-160335340 CTGAGGCAGGAGAACCTGGGAGG - Intronic
965593598 3:170385889-170385911 CTGAGGCAGGAGAATCTGGGAGG - Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
967095661 3:186175298-186175320 CTGAGGCAAGAGAAAGTGTGAGG + Intronic
967336695 3:188352088-188352110 TTAAGTCAGGAGAAGGAGGAAGG - Intronic
967442788 3:189528285-189528307 CTGAGGCAGGAGAACCTGGAAGG - Intergenic
967799308 3:193638244-193638266 CTGAGTGAGGGGAGAGTGGTAGG + Intronic
968531455 4:1094134-1094156 CTGAGGCAGGAGACTGAGGATGG - Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969666819 4:8562603-8562625 CTAAATCAGGAGAAGATGGAAGG + Intronic
970032223 4:11689240-11689262 CTGAGTGAAAAGAAAGTGGTTGG + Intergenic
970228639 4:13885858-13885880 CTGAGGCAATAGAATGTGGAAGG - Intergenic
970902830 4:21179276-21179298 CAGAGTGAGCAGAAAGTGCAAGG - Intronic
971504009 4:27347083-27347105 CTGACACAGGGGAAAATGGAAGG - Intergenic
971764875 4:30817979-30818001 CTGAGTGAGAAGAATGTGGCAGG - Intronic
971821214 4:31557606-31557628 GTGACTCAGCAGAAAATGGATGG - Intergenic
972816436 4:42651682-42651704 TTTAGCCAGGAGAAAATGGAAGG - Intronic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
973263221 4:48185954-48185976 CTGAGGCAGGAGAATCTGGCAGG - Intronic
973274117 4:48291052-48291074 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
973554383 4:52067478-52067500 CTGGGTCAGGGGAAAGTGACAGG - Intronic
974065646 4:57074402-57074424 CAGAGGCAGGAGAAAATGGTGGG - Intronic
974102074 4:57428449-57428471 CAGAGTCAGGGGAAAATGTAAGG - Intergenic
974310399 4:60200902-60200924 CTGAATCAGAATGAAGTGGAGGG - Intergenic
975109211 4:70605207-70605229 AAGAGTCAGGAGAAAGGAGAAGG + Intronic
975110414 4:70617224-70617246 CAGAGTCAGAAGAAAATGTAAGG - Intergenic
975165066 4:71169106-71169128 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
976767569 4:88613320-88613342 CTAACTCAGGAGAAAGTAAAAGG - Intronic
976886118 4:89986598-89986620 ATGAGTTTGGAGAAAGAGGAAGG - Intergenic
977204969 4:94157381-94157403 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
978643265 4:110896632-110896654 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
978959798 4:114662913-114662935 CTGAGGCAGGAGAACCTGGGAGG - Intronic
979458309 4:120951379-120951401 CTGAGTCCTCAGACAGTGGAGGG + Intergenic
980025774 4:127764641-127764663 CTGAGACAGGACTAAGTGCATGG - Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981576725 4:146213414-146213436 CTGTGTCAGGACCCAGTGGAGGG + Intergenic
981952187 4:150422894-150422916 CTGAACCAAGAGAAAGGGGATGG + Intronic
982373821 4:154664800-154664822 CTGAGGCAGGAGAACCAGGAAGG - Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982982133 4:162152115-162152137 CTGAGGCCTGAGAAAGTCGAAGG - Intronic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
984163015 4:176276933-176276955 ATAAGTCAGCAGAAAGTGGTAGG + Intronic
984412786 4:179416090-179416112 CTAAGACATGTGAAAGTGGAAGG - Intergenic
984594643 4:181653854-181653876 CTGGGTCGGGGGAAAGGGGAGGG - Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
984820152 4:183875098-183875120 CTAAGTCTGCAGACAGTGGAAGG - Intronic
985045863 4:185939830-185939852 TTGATTCTGGAGACAGTGGATGG - Intronic
985436805 4:189938641-189938663 CTGATTCAGGAGATCATGGATGG - Intergenic
985829542 5:2218077-2218099 CAGAGTCAGGAGGACTTGGAAGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
986026067 5:3852662-3852684 CTGAGTCAGGTGGGAGGGGAAGG + Intergenic
986891980 5:12320384-12320406 CAGTGTGAGGAGGAAGTGGATGG + Intergenic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987268154 5:16277748-16277770 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
988273021 5:29041647-29041669 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
988621779 5:32830292-32830314 CTGAGGCAGGAGCAAGTAAAGGG - Intergenic
988878190 5:35471435-35471457 CTGACTAAGGAGAAATTGAATGG - Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
988969419 5:36451292-36451314 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
988996138 5:36716571-36716593 CTGATTCAGGAGAACTGGGATGG + Intergenic
990059609 5:51630896-51630918 GTGAGTCAGGGGGAAGGGGAGGG + Intergenic
990319159 5:54612791-54612813 CTGACTCAGGAGACAGTGACAGG + Intergenic
990530983 5:56673484-56673506 GTGAGCGAGGAGACAGTGGAAGG + Intergenic
990570896 5:57077699-57077721 CTGAGACAGGAGAACCTGGGAGG - Intergenic
990978113 5:61576755-61576777 CTGAGTCAGGAGATACAAGATGG + Intergenic
991379200 5:66001955-66001977 GGGAGTGAGGGGAAAGTGGAGGG - Intronic
991588982 5:68229448-68229470 CTAAGTCAGGTGGAGGTGGAGGG - Intronic
991929022 5:71733391-71733413 CTGAATTAGCAGAAAGTGGGTGG + Intergenic
992397197 5:76378917-76378939 CTGAGGCAGGAGAAACCGGAAGG + Intergenic
992595225 5:78339925-78339947 CAGACTCAGGAAAAAGAGGAAGG - Intergenic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993554961 5:89325253-89325275 CTGATAAAGGAGGAAGTGGAAGG - Intergenic
993714454 5:91261634-91261656 CTGAGGCAGCAGAAAGCTGAAGG + Intergenic
993795952 5:92268072-92268094 CTGTGTTGGGAGAGAGTGGATGG - Intergenic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
996039535 5:118794605-118794627 CTTAGGGAGCAGAAAGTGGAGGG + Intergenic
997535331 5:134616039-134616061 CTGAGACAGGAGAATGTGGCAGG + Intronic
997753726 5:136374874-136374896 CTAAGTTAGGACCAAGTGGATGG - Intronic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998411898 5:141917564-141917586 CTGTGTCAGAAGAAAAGGGATGG + Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000113869 5:158135209-158135231 ATGGGGCAGGAGAAAGGGGATGG + Intergenic
1000289919 5:159860712-159860734 CTGTGTCTGTAGATAGTGGAAGG - Intergenic
1001241434 5:170074515-170074537 CTGACTCTGGAGAATGTGAATGG - Intronic
1001295172 5:170494100-170494122 CTGAGTGAGGAGACTGAGGAAGG - Intronic
1001713640 5:173797344-173797366 CTGAGGCTGCAGAAAGTGGGCGG - Intergenic
1001834737 5:174822481-174822503 CAGAGTAAGGAGAACATGGACGG + Intergenic
1002145901 5:177181126-177181148 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1003215904 6:4111542-4111564 ATGAGTAGGGTGAAAGTGGAAGG - Intronic
1003488032 6:6596303-6596325 CTGCCCCAGGAGAAAATGGATGG + Intronic
1003844083 6:10154703-10154725 CTGAGGCAGGAGAAATTGCTTGG - Intronic
1004015609 6:11729246-11729268 AAGAGTCAGGAGAAACTGCAAGG + Intronic
1004205604 6:13589225-13589247 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1004682502 6:17909793-17909815 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1006180666 6:32151759-32151781 GAGAGTCTGGAGACAGTGGAGGG + Intronic
1006419032 6:33921976-33921998 CCCAGTCAAGAGAAAGAGGAAGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006447044 6:34085425-34085447 GTGAGTCAGTAGAGAGAGGAAGG + Intronic
1007041200 6:38724074-38724096 CTGAGGCAGGAGAATCCGGAAGG - Intronic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007954279 6:45902195-45902217 TTGAGCTATGAGAAAGTGGATGG - Exonic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008401886 6:51072690-51072712 CAGACTCAGGAGAAAGGGTAAGG - Intergenic
1010512999 6:76743761-76743783 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1010620350 6:78065934-78065956 TTGAGTCAAGAGACAGTAGATGG - Intergenic
1010918365 6:81649351-81649373 TTGATTCAGGAGAGAATGGAAGG - Intronic
1011215056 6:84996729-84996751 CTGAGCCAGGAGAGTGTGGTAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1013851462 6:114521007-114521029 ATGAGTAAAGAGAAAGTGAATGG + Intergenic
1014262171 6:119231593-119231615 AGGAGTCAGGACAAGGTGGAGGG + Intronic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1015292987 6:131559664-131559686 CTGAGGCAGGAGAATGAGAATGG - Intergenic
1016802972 6:148185137-148185159 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1016858216 6:148693523-148693545 CTGAGTCAGGAGACTGAGGCAGG - Intergenic
1018525924 6:164710032-164710054 CAAAGGCAGGAGAATGTGGAAGG - Intergenic
1018990775 6:168671739-168671761 CAGCGTGAGGACAAAGTGGAGGG - Intronic
1019370136 7:658517-658539 CAGGGTCGGGAGAAAGTGGGAGG + Intronic
1020772482 7:12412123-12412145 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1021881836 7:25102490-25102512 CAGAGTCAGGAGCTAGAGGATGG - Intergenic
1021980144 7:26046246-26046268 CTGAGTCAGGATACAGAGTATGG + Intergenic
1022087095 7:27078801-27078823 ATGAGTCAGGAGTGAGTGGTGGG - Intergenic
1022509504 7:30926140-30926162 CTGAGGCAGGAAATAGTGTATGG + Intergenic
1022989198 7:35691463-35691485 ATGGGTCAGGAGTAGGTGGAGGG - Intronic
1023270253 7:38455167-38455189 CTGAGGCAGGAGGAGGTGGGAGG - Intronic
1023840230 7:44092950-44092972 CTGACTCAGGTGAGTGTGGACGG + Intergenic
1023980639 7:45068073-45068095 CTGAGGCATGGGAAAGTGAAAGG - Intronic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1024452645 7:49565088-49565110 CTGAGACAGGAGAATGAGTAAGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1027219511 7:76204956-76204978 CTGAGTGAGGAGAAAGGAGCTGG - Intronic
1027996374 7:85430390-85430412 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1029821511 7:103151543-103151565 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1031198510 7:118647379-118647401 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1031810417 7:126361007-126361029 TTGAGTCAAGATAAGGTGGAGGG + Intergenic
1032360245 7:131248737-131248759 CTGATTTAGGAAAAAGTGGATGG + Intronic
1033595825 7:142856997-142857019 CTGAGAGATGAGTAAGTGGAAGG - Intronic
1034254641 7:149717895-149717917 CTGAGGCAGGAGAACCTGGAAGG - Intronic
1035097190 7:156365312-156365334 CTGAACCAGAAGAAACTGGATGG + Intergenic
1035174011 7:157037699-157037721 GGGAGGCAGGAGAAAGGGGAGGG + Intergenic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1037690973 8:21181344-21181366 CTGTGTCAGGAGAGAGGGCAAGG - Intergenic
1038927360 8:32155343-32155365 CTGAGTCAGCAGAAAATTGAAGG - Intronic
1042438040 8:68791030-68791052 GTGAGTCTGGAGAAAAAGGAAGG + Intronic
1042598005 8:70470290-70470312 CTGAGTCAGGAAAGATTGGGAGG + Intergenic
1042922566 8:73934152-73934174 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1043871078 8:85433694-85433716 GGGAGTGGGGAGAAAGTGGAGGG + Intronic
1044034542 8:87284099-87284121 TTTACTCAGGAAAAAGTGGAGGG - Intronic
1044803010 8:95976365-95976387 CTGAGACAGGTGAAAGGGGCTGG - Intergenic
1046813705 8:118560453-118560475 AAGAGTCAGGAGACAGTGGATGG + Intronic
1047046388 8:121057304-121057326 CTTAGAGAGGAAAAAGTGGAGGG + Intergenic
1047169592 8:122478803-122478825 CTGAGAGAGGAGTAAGGGGAAGG + Intergenic
1047200149 8:122758418-122758440 CTGAGTCAGGAGAACATGATAGG + Intergenic
1047256695 8:123218763-123218785 GTGAGACAGAAGAATGTGGAAGG + Intergenic
1048012227 8:130467035-130467057 CTGACCCAGGGGAAAGAGGAGGG + Intergenic
1048114303 8:131504685-131504707 CTGAGTGAGATGATAGTGGAGGG - Intergenic
1049105446 8:140609604-140609626 CAGACTCAGGAGGAAGTGCAGGG - Intronic
1049539090 8:143198923-143198945 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1050475656 9:6038070-6038092 CTGAATCACGAGAATGTGGAGGG - Intergenic
1051167624 9:14281308-14281330 CTGAGTCTGAAGAAAGTGAAAGG + Intronic
1051213520 9:14771358-14771380 CTCAGTAAGGAAAAAGTGAAAGG + Intronic
1051276706 9:15405933-15405955 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1053347426 9:37388169-37388191 CTGAGGCAGGAGAAAGGTGGAGG - Intergenic
1053467854 9:38324132-38324154 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057164757 9:92916766-92916788 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1057697045 9:97330615-97330637 CTGAATGAGGAGAATGTGAAGGG + Exonic
1058070078 9:100592710-100592732 CTAAGTGAGGACCAAGTGGAAGG + Intergenic
1058390690 9:104491929-104491951 ATGAGTCAGAAGAAAATAGAAGG - Intergenic
1059358193 9:113717808-113717830 CTCAGTGGGGAGAGAGTGGAAGG + Intergenic
1060543328 9:124446493-124446515 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1061482324 9:130903249-130903271 CAGAGGCAGGAGAAATGGGATGG + Exonic
1062019656 9:134312781-134312803 CTAAGTCAGAAGTAAGTAGAAGG - Intergenic
1062026822 9:134344400-134344422 CTGAGTCAGGAGCAAAGGGGCGG - Intronic
1062066359 9:134528713-134528735 AGGAGTCAGGAGAATGTGAATGG - Intergenic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1185990079 X:4884112-4884134 CTGAGTCAGGAGAGACGGGAGGG - Intergenic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187355857 X:18570916-18570938 CTGAGTGAGGACAAAATGGCAGG - Intronic
1188191285 X:27174353-27174375 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1190261264 X:48798948-48798970 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1190777236 X:53562674-53562696 CTGGCTGAGGATAAAGTGGATGG + Intronic
1190797125 X:53756299-53756321 CTGAGTCAGGAGAAACGGAGAGG + Intergenic
1192083328 X:68069437-68069459 GGCATTCAGGAGAAAGTGGAGGG - Intronic
1192314785 X:70043197-70043219 ATGAGTCAGCAGAAAGTCAATGG + Exonic
1193406572 X:81108331-81108353 CTAAGACAGGAGGAAGAGGAGGG - Intergenic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1194391013 X:93318068-93318090 CTAGGAAAGGAGAAAGTGGAAGG + Intergenic
1196547165 X:116975731-116975753 CTGAGGCTGCAGAAAGTGGTGGG - Intergenic
1196617820 X:117787424-117787446 CTGAATCATCAGAAAGTGGCGGG + Intergenic
1196974794 X:121147530-121147552 CTGCCTCAGCAGAAAATGGAAGG + Intergenic
1197145398 X:123166732-123166754 CTCAGTTAAAAGAAAGTGGATGG + Intergenic
1197725487 X:129773575-129773597 CTGAGACAGGAGAATCTGGGAGG + Intergenic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1198367079 X:135951666-135951688 CAGAGTCAGGAGGAGATGGATGG + Intergenic
1199551950 X:149070235-149070257 AGGAGTCAGGAGAATGTGCATGG + Intergenic
1199586284 X:149420235-149420257 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1200207078 X:154324234-154324256 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1200958670 Y:8975590-8975612 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201236322 Y:11915449-11915471 CTGAATCAGGGCAAAGAGGAAGG - Intergenic
1202114668 Y:21459845-21459867 CTGACTCAGCAGAAATAGGAGGG + Intergenic
1202302745 Y:23434977-23434999 CTGAGGCAGGGGACACTGGAAGG + Intergenic
1202568066 Y:26235617-26235639 CTGAGGCAGGGGACACTGGAAGG - Intergenic