ID: 940213660 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:151282272-151282294 |
Sequence | TGACTTCGGTCTAGTGTAAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
940213660_940213662 | -3 | Left | 940213660 | 2:151282272-151282294 | CCTTTTACACTAGACCGAAGTCA | No data | ||
Right | 940213662 | 2:151282292-151282314 | TCACAGAAAGTTGTATAGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
940213660 | Original CRISPR | TGACTTCGGTCTAGTGTAAA AGG (reversed) | Intronic | ||