ID: 940213660

View in Genome Browser
Species Human (GRCh38)
Location 2:151282272-151282294
Sequence TGACTTCGGTCTAGTGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940213660_940213662 -3 Left 940213660 2:151282272-151282294 CCTTTTACACTAGACCGAAGTCA No data
Right 940213662 2:151282292-151282314 TCACAGAAAGTTGTATAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940213660 Original CRISPR TGACTTCGGTCTAGTGTAAA AGG (reversed) Intronic