ID: 940220541

View in Genome Browser
Species Human (GRCh38)
Location 2:151346753-151346775
Sequence CACTTGGAACATTTTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940220535_940220541 -1 Left 940220535 2:151346731-151346753 CCTCCATAAATGTGTTTCCCTTC No data
Right 940220541 2:151346753-151346775 CACTTGGAACATTTTGGCCCTGG No data
940220534_940220541 4 Left 940220534 2:151346726-151346748 CCGAACCTCCATAAATGTGTTTC No data
Right 940220541 2:151346753-151346775 CACTTGGAACATTTTGGCCCTGG No data
940220533_940220541 10 Left 940220533 2:151346720-151346742 CCATTTCCGAACCTCCATAAATG No data
Right 940220541 2:151346753-151346775 CACTTGGAACATTTTGGCCCTGG No data
940220532_940220541 29 Left 940220532 2:151346701-151346723 CCAAAGGAGTCATCTGTTTCCAT No data
Right 940220541 2:151346753-151346775 CACTTGGAACATTTTGGCCCTGG No data
940220536_940220541 -4 Left 940220536 2:151346734-151346756 CCATAAATGTGTTTCCCTTCACT No data
Right 940220541 2:151346753-151346775 CACTTGGAACATTTTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940220541 Original CRISPR CACTTGGAACATTTTGGCCC TGG Intergenic
No off target data available for this crispr