ID: 940221500

View in Genome Browser
Species Human (GRCh38)
Location 2:151356744-151356766
Sequence TACCCAAGGATTCTACACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940221497_940221500 17 Left 940221497 2:151356704-151356726 CCATTAGCATCAGCGGTAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 53
Right 940221500 2:151356744-151356766 TACCCAAGGATTCTACACAAAGG 0: 1
1: 0
2: 1
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940221500 Original CRISPR TACCCAAGGATTCTACACAA AGG Intergenic
902186268 1:14727822-14727844 CTCCCACGAATTCTACACAATGG - Intronic
902634974 1:17729128-17729150 GACCCCAGGGTTCTCCACAATGG - Intergenic
918395247 1:184107784-184107806 AACCCAAGCCTTCTACACAACGG + Intergenic
922653211 1:227358711-227358733 GACCCAAGTATTCTTCCCAATGG + Intergenic
923331520 1:232929471-232929493 TGCCAAAGGCTTCTACAAAATGG - Intergenic
1070902067 10:80038572-80038594 TAGCCAAGGCTTCTCCCCAATGG + Intergenic
1071699884 10:87919992-87920014 GACCCAACAATTCTACTCAAAGG - Intronic
1075179377 10:120196279-120196301 TACCCAAGCATTCCGCACAGAGG - Intergenic
1077782296 11:5344163-5344185 TACTGAAGGATTCTACAAGAGGG - Intronic
1088383741 11:109225840-109225862 TATCCAAGGATTTTTCAAAAAGG - Intergenic
1089363665 11:117907977-117907999 GACCAAAGGAGGCTACACAAAGG - Intronic
1090276687 11:125425036-125425058 TACTCAAGGACTCTAGAGAAGGG - Intronic
1090502104 11:127271151-127271173 AACCCAAGGGGTCTACAAAATGG + Intergenic
1097701744 12:62827514-62827536 TACCAAAGTATTTTAGACAAGGG - Intronic
1099719609 12:86343532-86343554 TGCCCAAAAATTCTAAACAAGGG + Intronic
1099995798 12:89777127-89777149 TTCCCAAGGATTCCTTACAAAGG - Intergenic
1101357525 12:103994576-103994598 AACCCAAAGATACTGCACAAGGG - Intronic
1104526498 12:129528549-129528571 GTCCCAAGAAGTCTACACAAAGG - Intronic
1108397730 13:50006532-50006554 TGCCTAAGAATTCTACACAAAGG - Intronic
1109206778 13:59491413-59491435 TACCCATGGGTTCCACACCACGG - Intergenic
1109766391 13:66905514-66905536 AACCCAAGGATTCTAAACTCTGG - Intronic
1110514149 13:76389059-76389081 TACCCAAGGATTCTCCAAGGAGG + Intergenic
1110892211 13:80706909-80706931 TACCCAAGGTTTCTAAAGGATGG + Intergenic
1114243244 14:20888975-20888997 TACGCAGGAAATCTACACAAGGG + Intergenic
1114250180 14:20953040-20953062 TACACAGGAAATCTACACAAGGG + Intergenic
1114314135 14:21494168-21494190 TACCCAAGGATCCTAAACTTTGG + Intronic
1114706721 14:24734853-24734875 TAACCAAGCTTACTACACAAAGG - Intergenic
1116766208 14:49073209-49073231 TACCCATAGATTCAAAACAAAGG + Intergenic
1119148762 14:72339476-72339498 CACCAAAGGATTCAACAGAATGG - Intronic
1125956980 15:43797283-43797305 CACCCTAGGATTCTACAGCATGG - Exonic
1127925739 15:63538984-63539006 TTCCCAAGATTTTTACACAAAGG + Intronic
1128110534 15:65073307-65073329 CACCCATGGATTCTACATTATGG - Intronic
1129988354 15:79938783-79938805 TTCCCAAGTATTCTCCAAAATGG + Intergenic
1132551213 16:554565-554587 TACCATAGGATTCTCCACAGTGG + Exonic
1134111633 16:11518648-11518670 CACCCAAGGCTTCTACATGAAGG + Intronic
1134781137 16:16896433-16896455 TACCCAAGGATGCTGAGCAAGGG + Intergenic
1138777938 16:59747363-59747385 TACCCAAGGATGCTAGAATATGG + Intronic
1142248775 16:88981595-88981617 TGCCCAAGGAGTCCACACACCGG - Intergenic
1144790508 17:17855905-17855927 GACTCAAGGTTTCTACACTATGG + Intronic
1146137678 17:30337554-30337576 TTCCAAGGGACTCTACACAATGG + Intergenic
1150717736 17:67586212-67586234 TATTCAAGGATTTTAAACAAAGG + Intronic
1150831397 17:68523036-68523058 TACCCAAGAATTGTACAGGATGG - Intronic
1153649678 18:7229123-7229145 GCCCCAGGGATTCTAGACAAAGG - Intergenic
1154226481 18:12509479-12509501 TATCCAAGTATTCTTCATAAAGG + Intronic
1156549243 18:37998157-37998179 TTCCCAAAGCTTCAACACAAGGG - Intergenic
1157963241 18:52180053-52180075 AACCCTAAGATTCTACACAAAGG - Intergenic
1158228825 18:55230753-55230775 TACCCAGAGATTCTCCAAAATGG - Intronic
1160126188 18:76174566-76174588 TCTCCAAGGATACTACAAAAAGG - Intergenic
1160128405 18:76201949-76201971 TACCCAATGATTTTTGACAAAGG + Intergenic
1162077869 19:8200635-8200657 TGCCAAAGGTTTCTCCACAAAGG - Intronic
1163981625 19:20906065-20906087 TACCCACTCATTCTTCACAATGG + Intergenic
925787434 2:7446591-7446613 CACCCATGGAATCTACAGAAGGG - Intergenic
926080395 2:9981019-9981041 TTCCCATGGATTCTACCTAATGG - Intronic
926204316 2:10824373-10824395 CACCCAGGGTTGCTACACAATGG - Intronic
926608862 2:14925091-14925113 TCCCCAAGGAATTTTCACAAAGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
935065279 2:99641944-99641966 TACCCAAGGATTCCACTCGCAGG - Intronic
937612552 2:123879313-123879335 TACCACATGATTCTACCCAAAGG - Intergenic
940221500 2:151356744-151356766 TACCCAAGGATTCTACACAAAGG + Intergenic
942914011 2:181280548-181280570 TATTAAAGGATTCTAAACAACGG + Intergenic
943798780 2:192031728-192031750 CTCTCAAGGGTTCTACACAAGGG - Intronic
944855305 2:203761576-203761598 TTTCTAAGGAATCTACACAAAGG - Intergenic
946645982 2:221834532-221834554 CACTCAAGGCGTCTACACAAAGG + Intergenic
1169008797 20:2232322-2232344 TGCCCAAGGTTTCTACACGGGGG + Intergenic
1169729995 20:8776370-8776392 TAGCCGAGGCATCTACACAATGG - Intronic
1172301453 20:33853239-33853261 AAAACAAGGATTCTACACAGAGG - Intronic
1172373950 20:34420707-34420729 TACCCAAGGATTTCAGACACTGG - Intronic
1175714187 20:61244755-61244777 AACCCAAGTATGCTACACAAAGG + Intergenic
1177270030 21:18835642-18835664 TAACCCAGGATTCAACCCAAAGG - Intergenic
950589012 3:13922046-13922068 TTCCCAATGATTCTACATTATGG - Intergenic
952038925 3:29238133-29238155 GACCCAATGATTCTACTCACAGG - Intergenic
954308863 3:49748868-49748890 CTCCCAAGGATTCTACATTATGG - Intronic
955643839 3:61115202-61115224 TATCCACTGATTATACACAATGG - Intronic
956522458 3:70120967-70120989 TACCCTCTGATTCTACATAATGG - Intergenic
961408313 3:126699121-126699143 TCCCCAAGGATTCTTCACAGTGG + Intergenic
962566084 3:136661655-136661677 TCCCCAAGCATTTTACATAAGGG + Intronic
963438106 3:145298188-145298210 TACCCATGGATTCTGTAGAATGG - Intergenic
967517054 3:190382464-190382486 TGCCCAAGCATTCTCCACATTGG + Intronic
967565872 3:190971623-190971645 TACCCAAGTATTCTACCTACAGG + Intergenic
967579543 3:191136220-191136242 TATACAAAGATTTTACACAATGG - Intergenic
967872887 3:194246776-194246798 TACAGAAGGATTGTAAACAATGG - Intergenic
969659937 4:8520941-8520963 TACCCAAGCTTTCTAGAAAATGG + Intergenic
970760286 4:19477264-19477286 TACACAAAGAATTTACACAAAGG - Intergenic
975529699 4:75387313-75387335 TACTCAACGATTCCAAACAACGG - Intergenic
984254368 4:177373314-177373336 GACACAAGGAATCTTCACAAAGG + Intergenic
986205993 5:5625847-5625869 TAAACAGGGATTTTACACAATGG - Intergenic
986629504 5:9756133-9756155 TACCCCAAGAGTCTACACGAGGG + Intergenic
990551176 5:56881072-56881094 TACCAATGGATCCTACAAAAAGG - Exonic
996567745 5:124897792-124897814 TTCCCACTGATTCTACACTATGG + Intergenic
997090777 5:130854763-130854785 TACTCAAGGATTGTACATTAAGG - Intergenic
997846383 5:137290091-137290113 AACCCTAGGATTTTACCCAATGG + Intronic
998219897 5:140268674-140268696 TACTCAAGGAATCTAAACACAGG + Intronic
998240675 5:140441257-140441279 TACTCAAAGATTCTACACAAGGG - Intronic
998425859 5:142028124-142028146 CACCCAAGGATTATATACTATGG - Intergenic
1004668585 6:17773488-17773510 TACCCAGGGATTCTCCTCGAAGG - Exonic
1008951807 6:57169980-57170002 TTGCCAGAGATTCTACACAAAGG + Exonic
1012074506 6:94668077-94668099 TTCCCAAGGAAACCACACAAAGG - Intergenic
1012138300 6:95586843-95586865 TAGCCAAGAATTATCCACAAGGG + Exonic
1016501111 6:144721657-144721679 ATCCCAAGAATTTTACACAAAGG - Intronic
1017318309 6:153058354-153058376 TATCTCAGGGTTCTACACAAAGG + Intronic
1021243273 7:18231304-18231326 TACCCAATGAGTCTATGCAATGG - Intronic
1029839687 7:103348792-103348814 TATCCAAGGCATCTACCCAATGG + Intronic
1031339985 7:120587928-120587950 GACCCCAGGATTCTAAACATAGG - Intronic
1033022280 7:137738448-137738470 TACCAAAGAATTATTCACAATGG + Intronic
1037463628 8:19137827-19137849 TTCCCACTGATTCTACACAATGG + Intergenic
1039032909 8:33329081-33329103 TACCCAAGAATTGTACACACTGG + Intergenic
1044490658 8:92810153-92810175 TATCCAATGCTTCGACACAATGG - Intergenic
1045406363 8:101870639-101870661 GACTCATGTATTCTACACAAAGG + Intronic
1047564676 8:126031002-126031024 TTCCCAAGGATTCCACATCAAGG + Intergenic
1050310880 9:4352344-4352366 GACCAAGGGACTCTACACAAAGG - Intergenic
1057005266 9:91551794-91551816 TATCCAAGGTTTCTGCAGAAGGG + Intergenic
1059256468 9:112935667-112935689 TGCCCCAGGATCCTACACACAGG - Intergenic
1188409985 X:29860101-29860123 TGACCAAGGATACTTCACAAAGG + Intronic
1189665291 X:43349120-43349142 TAGCAAAGGATTCTAAAAAATGG - Intergenic
1189929149 X:45989463-45989485 GACCCATGCATTCTACATAAGGG - Intergenic
1191237521 X:58146238-58146260 CACCCGAAGATTCTACAAAAAGG - Intergenic
1192619851 X:72668321-72668343 TACCCAATGATTCTACTTCAGGG - Intronic
1195152158 X:102083187-102083209 TATCCAAGAACTCTACATAAAGG - Intergenic
1196244205 X:113379909-113379931 TACCAAAGGTTTCTACAGAAAGG - Intergenic
1198889496 X:141377292-141377314 GTCCCAAGGTTTCTACAGAAGGG + Intergenic