ID: 940225075

View in Genome Browser
Species Human (GRCh38)
Location 2:151392700-151392722
Sequence CTCTAGTGAGCTGTCCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940225075_940225078 3 Left 940225075 2:151392700-151392722 CCAACCAGGACAGCTCACTAGAG No data
Right 940225078 2:151392726-151392748 CTGTGCCCAAAGCTTCTATTGGG No data
940225075_940225080 5 Left 940225075 2:151392700-151392722 CCAACCAGGACAGCTCACTAGAG No data
Right 940225080 2:151392728-151392750 GTGCCCAAAGCTTCTATTGGGGG No data
940225075_940225084 18 Left 940225075 2:151392700-151392722 CCAACCAGGACAGCTCACTAGAG No data
Right 940225084 2:151392741-151392763 CTATTGGGGGGTAAGCATGTAGG No data
940225075_940225079 4 Left 940225075 2:151392700-151392722 CCAACCAGGACAGCTCACTAGAG No data
Right 940225079 2:151392727-151392749 TGTGCCCAAAGCTTCTATTGGGG No data
940225075_940225081 6 Left 940225075 2:151392700-151392722 CCAACCAGGACAGCTCACTAGAG No data
Right 940225081 2:151392729-151392751 TGCCCAAAGCTTCTATTGGGGGG No data
940225075_940225077 2 Left 940225075 2:151392700-151392722 CCAACCAGGACAGCTCACTAGAG No data
Right 940225077 2:151392725-151392747 ACTGTGCCCAAAGCTTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940225075 Original CRISPR CTCTAGTGAGCTGTCCTGGT TGG (reversed) Intergenic
No off target data available for this crispr