ID: 940225077

View in Genome Browser
Species Human (GRCh38)
Location 2:151392725-151392747
Sequence ACTGTGCCCAAAGCTTCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940225076_940225077 -2 Left 940225076 2:151392704-151392726 CCAGGACAGCTCACTAGAGACAC No data
Right 940225077 2:151392725-151392747 ACTGTGCCCAAAGCTTCTATTGG No data
940225075_940225077 2 Left 940225075 2:151392700-151392722 CCAACCAGGACAGCTCACTAGAG No data
Right 940225077 2:151392725-151392747 ACTGTGCCCAAAGCTTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940225077 Original CRISPR ACTGTGCCCAAAGCTTCTAT TGG Intergenic
No off target data available for this crispr