ID: 940225079

View in Genome Browser
Species Human (GRCh38)
Location 2:151392727-151392749
Sequence TGTGCCCAAAGCTTCTATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940225076_940225079 0 Left 940225076 2:151392704-151392726 CCAGGACAGCTCACTAGAGACAC No data
Right 940225079 2:151392727-151392749 TGTGCCCAAAGCTTCTATTGGGG No data
940225075_940225079 4 Left 940225075 2:151392700-151392722 CCAACCAGGACAGCTCACTAGAG No data
Right 940225079 2:151392727-151392749 TGTGCCCAAAGCTTCTATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940225079 Original CRISPR TGTGCCCAAAGCTTCTATTG GGG Intergenic
No off target data available for this crispr