ID: 940225084

View in Genome Browser
Species Human (GRCh38)
Location 2:151392741-151392763
Sequence CTATTGGGGGGTAAGCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940225076_940225084 14 Left 940225076 2:151392704-151392726 CCAGGACAGCTCACTAGAGACAC No data
Right 940225084 2:151392741-151392763 CTATTGGGGGGTAAGCATGTAGG No data
940225075_940225084 18 Left 940225075 2:151392700-151392722 CCAACCAGGACAGCTCACTAGAG No data
Right 940225084 2:151392741-151392763 CTATTGGGGGGTAAGCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940225084 Original CRISPR CTATTGGGGGGTAAGCATGT AGG Intergenic
No off target data available for this crispr