ID: 940231941

View in Genome Browser
Species Human (GRCh38)
Location 2:151464116-151464138
Sequence TTCTAGTTTGATACCGTGTT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940231941_940231943 -10 Left 940231941 2:151464116-151464138 CCGAACACGGTATCAAACTAGAA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 940231943 2:151464129-151464151 CAAACTAGAAGAGCATCTCAGGG 0: 1
1: 0
2: 2
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940231941 Original CRISPR TTCTAGTTTGATACCGTGTT CGG (reversed) Exonic
908997156 1:70168825-70168847 TTCTCTTTTGATACCTTCTTTGG - Intronic
909102837 1:71371725-71371747 TTCTACTTGGATACAGTGCTAGG - Intergenic
913187059 1:116378545-116378567 TTCTAGTCTGTTACCATGTAGGG + Intronic
915890328 1:159767514-159767536 TTGTAGTTTGATGCCATGATTGG - Intergenic
918012582 1:180601914-180601936 TTTTAGATTGATACAGTGTGTGG + Intergenic
918294301 1:183141476-183141498 ATCCAGTTTGATAGGGTGTTAGG + Intronic
918339247 1:183553642-183553664 TTTTAGTTTGACATGGTGTTTGG + Exonic
918613174 1:186514668-186514690 TTCTAGTTTTATTTCGAGTTGGG + Intergenic
921379827 1:214513042-214513064 TTCTAGTTTGAATTGGTGTTTGG - Intronic
1065205272 10:23351504-23351526 TTCTAGCTTGATTCCTTCTTTGG + Intergenic
1066164568 10:32772564-32772586 TTATATTGTGAAACCGTGTTGGG + Intronic
1069333342 10:67319398-67319420 TTTTAGTGTGCTACCGGGTTGGG - Intronic
1072132004 10:92503306-92503328 TTATATTATGATACAGTGTTTGG - Intronic
1075492399 10:122883064-122883086 TTCCATTTTGATACTGTTTTTGG + Intergenic
1075797061 10:125128179-125128201 TCCTAGTTTGCTTCCGTGTGAGG - Intronic
1077277640 11:1721838-1721860 TTTTAGTTTGTTACCGATTTGGG - Intergenic
1080138513 11:28887401-28887423 TTCTAGTTTAATTCCATTTTGGG + Intergenic
1080636054 11:34124178-34124200 TTTTATTTTGATACAGTGCTGGG + Intronic
1086355136 11:85988860-85988882 TTCTAATGAGATACAGTGTTGGG - Intronic
1086356702 11:86008765-86008787 TTCTGTTTTGAGACTGTGTTTGG - Intronic
1088700077 11:112403750-112403772 GTTGTGTTTGATACCGTGTTAGG + Intergenic
1090592703 11:128290071-128290093 TTCTAGTTTGATGCCAAGTAAGG - Intergenic
1104819794 12:131669380-131669402 TTCTAGTTTCATCCCGTTGTTGG - Intergenic
1108806060 13:54157894-54157916 TTCTAATTTAAGACTGTGTTAGG - Intergenic
1109996664 13:70136038-70136060 TTCTAATTTGCTTCTGTGTTTGG - Intergenic
1111690934 13:91562152-91562174 TTCTCTTTTGATAACATGTTTGG - Intronic
1111752315 13:92348733-92348755 TTCTAGTTTTATACCATTGTGGG - Intronic
1114274145 14:21126628-21126650 TTCTAGTTTTATACCGTTGTAGG - Intergenic
1123775906 15:23579649-23579671 TTATAGTTTGATACTTTTTTAGG - Intronic
1124881188 15:33644382-33644404 TTCAAGTTTTATACCATGTGCGG + Exonic
1125980116 15:43993084-43993106 TTCTAGTTTCATACTTTGGTGGG + Intronic
1131713513 15:95081583-95081605 TTGTACTCTGATATCGTGTTGGG + Intergenic
1132037140 15:98493896-98493918 GTCTAGTTTGATTCCTTGATTGG - Intronic
1153594180 18:6707344-6707366 TTGTAGTTAGAGAACGTGTTTGG + Intergenic
1155751631 18:29429962-29429984 TTCTCTTTTGATACTGTTTTTGG - Intergenic
1159965271 18:74588971-74588993 TCCTAGTTTGAAACCTTCTTGGG + Intergenic
1161762311 19:6183232-6183254 TTCTGGTTGGATATCGTGTGGGG - Exonic
940231941 2:151464116-151464138 TTCTAGTTTGATACCGTGTTCGG - Exonic
947313302 2:228827740-228827762 TTCTAGTTTGATAATGTCTTTGG + Intergenic
948294901 2:236853436-236853458 TGCTAGTTTGATTCCATGTAAGG - Intergenic
1170514328 20:17112377-17112399 TTATAGTATCATACCGTTTTAGG + Intergenic
1174847072 20:53952786-53952808 TTCTACTTTGCTTCCATGTTTGG + Intronic
1177994340 21:28077105-28077127 TTCTAGGTTGATACTGTTCTAGG - Intergenic
1178611657 21:34087521-34087543 TTTAAGTTTTATAGCGTGTTAGG + Intronic
949181435 3:1135978-1136000 TTCTATTTTGAGACAGAGTTTGG - Intronic
957339283 3:78872587-78872609 TGCTTGTTTGATACAATGTTAGG - Intronic
957943341 3:87032909-87032931 TTTTGGTTGGATACCGTCTTGGG - Intergenic
962353003 3:134669355-134669377 TTCTGGTCAGATACTGTGTTGGG + Intronic
965188858 3:165503373-165503395 TTCTAGTTTTATATTGTGCTTGG + Intergenic
966031403 3:175352488-175352510 TTCAAGTTTCTTACCTTGTTAGG + Intronic
970254049 4:14148534-14148556 TTCTATTTTCAAACCCTGTTTGG + Intergenic
971452733 4:26815130-26815152 TTCCTGTTTGACACAGTGTTGGG - Intergenic
976231707 4:82850969-82850991 TTTTAGTTTGATACTGTCTGTGG - Intronic
978511562 4:109525440-109525462 TTCTTGTGAGATACCGTTTTAGG - Exonic
978526153 4:109668303-109668325 ATGTAGTTTGATGCTGTGTTAGG + Intronic
978743796 4:112168673-112168695 TTTTAATTTGAGACAGTGTTTGG + Intronic
979746440 4:124219586-124219608 TTCTGGTTTGAAACAGTTTTAGG - Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
984135808 4:175936652-175936674 TTCTGGTTTGATATCTTGTTAGG - Intronic
985385688 4:189445529-189445551 TTCTAGGTTGAAACCTTTTTTGG + Intergenic
985580256 5:692421-692443 TGCTATTTTGATACGGGGTTGGG - Intronic
1007630894 6:43272854-43272876 TTCAAGATTGATACCCTGCTTGG + Intronic
1008565477 6:52763949-52763971 ATCTGGTTTCATACCGTGTTTGG - Intergenic
1008569665 6:52804290-52804312 ATCTGGTTTCATACCGTGTTTGG - Intergenic
1008574434 6:52846566-52846588 ATCTGGTTTCATACCGTGTTTGG - Intronic
1008600017 6:53083897-53083919 TTCTAGTCTCATCCCATGTTGGG + Intronic
1011426051 6:87231349-87231371 TTCTAGCTTTATACAGTGTGAGG - Intronic
1020397636 7:7735234-7735256 TTCTAATTTGATCCCGTAATGGG - Intronic
1021029606 7:15714989-15715011 TTATTGTTTGATACTGTGATAGG + Intergenic
1021043844 7:15896836-15896858 ATGTAGTTTGATACTCTGTTAGG - Intergenic
1028068802 7:86423309-86423331 TTATAGTTTGTCACTGTGTTAGG + Intergenic
1029248712 7:99220973-99220995 TTCTTTTTTTATACTGTGTTTGG - Intergenic
1031159876 7:118153633-118153655 TTCTACTTTTAAACTGTGTTGGG + Intergenic
1032221389 7:129997149-129997171 TTCTAGTTTGAGTTGGTGTTTGG + Intergenic
1036047634 8:5161545-5161567 TTCGAGGTTTATACCGTGTAAGG - Intergenic
1041484681 8:58361936-58361958 TTCTAGTTTTATACCATTGTGGG - Intergenic
1043817612 8:84822013-84822035 TTGTAGTTTTATTCAGTGTTAGG + Intronic
1047682535 8:127268926-127268948 TTCTACTTGGGTACCATGTTGGG + Intergenic
1047883434 8:129221157-129221179 TTATAGTTTTATATTGTGTTAGG - Intergenic
1047887224 8:129265195-129265217 TTCTGGGTTGATACAATGTTAGG + Intergenic
1052075271 9:24134014-24134036 TTCTATTTTGCTAACGTGGTTGG + Intergenic
1052081000 9:24205145-24205167 TTATAGTTTGATGCCATATTGGG + Intergenic
1055368187 9:75568513-75568535 GTCAAGTTTGATAACGTGGTTGG - Intergenic
1056342708 9:85653426-85653448 TTCTTGTTTGTTCCCGTGTTTGG + Intronic
1058081212 9:100702890-100702912 TTCTAGTCTGAGACCATGTAGGG + Intergenic
1060426223 9:123508829-123508851 TTCAAGTTTGAAAATGTGTTAGG - Intronic
1187541029 X:20195129-20195151 TTATAGTTCGAGACCGAGTTCGG - Exonic
1191922647 X:66272961-66272983 TTGTGGTTTGAGACTGTGTTTGG - Intergenic
1194801866 X:98283710-98283732 TTCTACTTTGATACAAAGTTGGG + Intergenic
1200255644 X:154581204-154581226 TTCGACTTTGATGCCCTGTTGGG + Intergenic
1200262125 X:154623200-154623222 TTCGACTTTGATGCCCTGTTGGG - Intergenic
1201713917 Y:17022721-17022743 TTCTACTTTGCTTCTGTGTTTGG - Intergenic