ID: 940232208

View in Genome Browser
Species Human (GRCh38)
Location 2:151467685-151467707
Sequence ATCTGATTCTAGGAACTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940232208_940232210 3 Left 940232208 2:151467685-151467707 CCATAAAGTTCCTAGAATCAGAT No data
Right 940232210 2:151467711-151467733 ACACTTTTAACTGCCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940232208 Original CRISPR ATCTGATTCTAGGAACTTTA TGG (reversed) Intronic
No off target data available for this crispr