ID: 940236490

View in Genome Browser
Species Human (GRCh38)
Location 2:151516460-151516482
Sequence GAGTCTCAGCAGATGCAGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940236490_940236494 19 Left 940236490 2:151516460-151516482 CCACTCTGCATCTGCTGAGACTC 0: 1
1: 0
2: 0
3: 28
4: 268
Right 940236494 2:151516502-151516524 GGTGTTTCAAAGTCCAGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 114
940236490_940236493 18 Left 940236490 2:151516460-151516482 CCACTCTGCATCTGCTGAGACTC 0: 1
1: 0
2: 0
3: 28
4: 268
Right 940236493 2:151516501-151516523 TGGTGTTTCAAAGTCCAGCATGG 0: 1
1: 0
2: 0
3: 25
4: 255
940236490_940236492 -2 Left 940236490 2:151516460-151516482 CCACTCTGCATCTGCTGAGACTC 0: 1
1: 0
2: 0
3: 28
4: 268
Right 940236492 2:151516481-151516503 TCTTTGGCAGTGATGTACGTTGG 0: 1
1: 0
2: 1
3: 1
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940236490 Original CRISPR GAGTCTCAGCAGATGCAGAG TGG (reversed) Exonic
901971663 1:12913453-12913475 GAGTCCCAGGAGAGGAAGAGCGG - Intronic
902013504 1:13288287-13288309 GAGTCCCAGGAGAGGAAGAGCGG + Intergenic
903022740 1:20405339-20405361 GAGTCTCACCAGGCACAGAGTGG - Intergenic
903119812 1:21208337-21208359 AAGTCTCTGCGAATGCAGAGTGG - Intergenic
904938224 1:34146917-34146939 GAGTCTCAGCATTTGGACAGTGG + Intronic
906616008 1:47233166-47233188 GCGGCTCAGCTGATGAAGAGGGG + Intergenic
910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG + Intronic
910199965 1:84689956-84689978 GAGTCTCAGCAGCGGCCGTGGGG - Intronic
910799759 1:91133352-91133374 AAGTCTCTGCATAGGCAGAGAGG - Intergenic
911417308 1:97590828-97590850 GAGTGGCATCAGAAGCAGAGAGG - Intronic
911881208 1:103240367-103240389 GAGTCTCACCATTAGCAGAGAGG - Intergenic
915180837 1:154058040-154058062 GAGTCTTATGATATGCAGAGTGG + Intronic
916175086 1:162031408-162031430 GGGTCACAGCAGAGGGAGAGAGG + Intergenic
916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG + Intronic
916503434 1:165406745-165406767 GGGGCTCAGTAGATGAAGAGTGG + Intronic
917509953 1:175661761-175661783 GAGGATGAGCAGATGTAGAGGGG - Intronic
917512542 1:175680286-175680308 GAGTCTCAGAAAAGGGAGAGGGG + Intronic
917967479 1:180187668-180187690 GAGACTCAGCAGGCACAGAGGGG - Intronic
918312325 1:183293599-183293621 GAATCTTAGCAGAGACAGAGCGG + Intronic
919756017 1:201066657-201066679 GACTGGCAGGAGATGCAGAGAGG - Intronic
919860237 1:201735105-201735127 GGGGGTCAGCAGATGCACAGTGG - Intronic
920314564 1:205068180-205068202 GCCTCTCAGCAGATGCTGACTGG - Intronic
920823331 1:209401649-209401671 CAGTGTCAGCCGCTGCAGAGAGG + Intergenic
921941714 1:220847357-220847379 GAGTAGGAGCAGATGAAGAGAGG - Intergenic
922050274 1:221982757-221982779 TAGTATCAGCAGATGGATAGAGG - Intergenic
922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG + Intronic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1063635771 10:7781151-7781173 GAGTCACAGGAGATGCCCAGAGG + Intronic
1063700796 10:8383495-8383517 GAATCTCAGCAGATGAAGGAAGG - Intergenic
1064129831 10:12699294-12699316 GAGTCACAGCAAAAGCAGACCGG - Intronic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1066523522 10:36249656-36249678 GTGTCTCAGTGGATGAAGAGAGG - Intergenic
1067232663 10:44423025-44423047 GAGTCTTTGCAGAATCAGAGAGG - Intergenic
1067250853 10:44586311-44586333 GAGTCTCTGCAGGTGAAGGGAGG + Intergenic
1070439488 10:76429429-76429451 GAGTCTCAGAGGCTGCAGCGAGG + Intronic
1070596210 10:77834782-77834804 GGGTCTGAGCAGAAGCAGACAGG + Intronic
1072325210 10:94291451-94291473 GAGACTCAGCTGAGGAAGAGAGG + Intronic
1072616656 10:97054088-97054110 GAGGCTCACCAGAAGCCGAGCGG - Intronic
1072896166 10:99368702-99368724 GGGTCTCTGTAGATCCAGAGGGG + Intronic
1072953664 10:99870273-99870295 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1073651652 10:105366860-105366882 AATTCTCAGCTGCTGCAGAGGGG - Intergenic
1074322361 10:112414971-112414993 GACTCTCAGCAGATGCTAAATGG + Intronic
1075378253 10:121997075-121997097 TAGTCTCAGATGCTGCAGAGAGG + Intronic
1075390583 10:122088105-122088127 GAGCCTCAGGACATCCAGAGGGG - Intronic
1075541807 10:123319816-123319838 CAGCCTCATGAGATGCAGAGTGG + Intergenic
1077378077 11:2214961-2214983 GAGGATGAGCAGAGGCAGAGTGG - Intergenic
1077606683 11:3617121-3617143 GAGTCACACCAGGTGCAAAGCGG - Intergenic
1080723600 11:34872939-34872961 GAATCTCTGAAGATACAGAGAGG - Intronic
1080799794 11:35599564-35599586 GAGTTTCTGCAGCTGCAGAGAGG + Intergenic
1081773299 11:45662811-45662833 GAGTCACAGCAGCAGCTGAGCGG + Intronic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1083346999 11:62000855-62000877 AAGTCTCAACAGAGGCAGAGTGG - Intergenic
1083787443 11:64959803-64959825 GAATCTCAGTGGATACAGAGAGG + Intronic
1083842206 11:65310880-65310902 GACTCTCAGCAGATGGGCAGGGG + Intergenic
1083881959 11:65553307-65553329 GGGGCACAGCAGATGTAGAGAGG + Intronic
1084091015 11:66879427-66879449 GAGTGTCAGGTGTTGCAGAGAGG + Intronic
1084324451 11:68391581-68391603 GAGTCTCAGCACCTTCAGGGTGG + Intronic
1084464846 11:69316495-69316517 GAGTCTCAGCAGAGGAGTAGGGG - Intronic
1084900761 11:72308218-72308240 GAGGCTCTGCGCATGCAGAGTGG + Intronic
1085940457 11:81200837-81200859 GTCTCTCAGCACATGCATAGTGG - Intergenic
1085989814 11:81828118-81828140 GAGTCTAAACAGATGTAAAGAGG - Intergenic
1086184817 11:84000404-84000426 GGGTCTCAGAAGATGAAGAAAGG + Intronic
1090246001 11:125216443-125216465 GAGTCCCGGCAGGTGCTGAGGGG + Intronic
1091105336 11:132913898-132913920 GAGCTGCAGCAGAGGCAGAGAGG - Intronic
1093287705 12:17285151-17285173 CAGCCTCAGGAGATGCATAGTGG + Intergenic
1093653082 12:21666032-21666054 AAATCTCAGCAGATTCACAGAGG + Intronic
1093767777 12:22984558-22984580 GTGTCACAGCAAATGCAGAAAGG - Intergenic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1095513201 12:42976085-42976107 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1095898317 12:47302764-47302786 GAGAAACAGCAGATGCAGAAAGG + Intergenic
1096904601 12:54923414-54923436 GAATCACAGCAGATTCAGAGAGG + Intergenic
1096912605 12:54999196-54999218 GAATCACAGCAGATTCAGAGAGG + Intergenic
1097713867 12:62944443-62944465 GAGATTCAGCAGATGCAGAAAGG - Intergenic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1101414536 12:104497874-104497896 GATACTCAGCACATGCAGGGTGG - Intronic
1103557735 12:121776176-121776198 GGCTCACAGCAGAAGCAGAGTGG - Exonic
1105978447 13:25494376-25494398 GAGTCTCTGCAGTGGCAGAAAGG - Intronic
1106019421 13:25900366-25900388 GACTCTCAGAGGATGCAGTGAGG - Intronic
1106769718 13:32950291-32950313 GAGTCTCAGGAAAGGCAGAAAGG + Intergenic
1107020653 13:35747548-35747570 TAATCTCAGCAGATGCAGTTGGG - Intergenic
1107380742 13:39854241-39854263 GAGTGTGAGCCGAAGCAGAGCGG - Intergenic
1112165766 13:96918541-96918563 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1112364078 13:98742079-98742101 GAGTCTCAGCAGACGCCTGGTGG + Intronic
1113289653 13:108890551-108890573 AAGGCTCATCATATGCAGAGGGG + Intronic
1114185083 14:20395130-20395152 GAATCAGAGCAGAAGCAGAGAGG + Intronic
1115763091 14:36595199-36595221 GAGTCTGAGCACAGGCATAGGGG + Intergenic
1119736444 14:76985758-76985780 TAGTCCCAGAAGATGCAGGGAGG - Intergenic
1120711325 14:87796275-87796297 GAATCACAGCAGAGTCAGAGAGG + Intergenic
1122194225 14:100073157-100073179 GAGTGTCAGCAAAGGCAGAGTGG - Intronic
1122483639 14:102063801-102063823 GGGTCCCAGCAGACGCAGAATGG + Intergenic
1122614884 14:103010429-103010451 GAGTCTCACCAGAGGGATAGGGG - Intronic
1123020257 14:105394634-105394656 GAGTGTCCGAAGATGCAGATGGG - Exonic
1123509776 15:20985567-20985589 GAATCACAGCAGATTCACAGAGG - Intergenic
1123566996 15:21559306-21559328 GAATCACAGCAGATTCACAGAGG - Intergenic
1123603260 15:21996599-21996621 GAATCACAGCAGATTCACAGAGG - Intergenic
1124708424 15:31984676-31984698 GAGTCTTAGCTTAAGCAGAGAGG + Intergenic
1125135880 15:36342088-36342110 GAGTGTCAACAGATGCTGAGGGG + Intergenic
1125914721 15:43475603-43475625 GAGCTGCAGGAGATGCAGAGTGG + Exonic
1126374570 15:47983697-47983719 GAATCACAGCAGATTCACAGAGG + Intergenic
1126377831 15:48013700-48013722 CAGCCTCAGCAGATGCTGACAGG - Intergenic
1126864488 15:52922325-52922347 GAGCCACAGCAGATACAAAGAGG + Intergenic
1127867952 15:63047219-63047241 GAGTCTCAGCAGAGGCTGTGAGG + Intronic
1128618302 15:69127709-69127731 GAGTCTGAGCATAAGCAGTGAGG + Intergenic
1202975357 15_KI270727v1_random:286400-286422 GAATCACAGCAGATTCACAGAGG - Intergenic
1132761324 16:1509881-1509903 GAGTCTCTGCAGAAGCAGCAGGG - Exonic
1132975553 16:2709594-2709616 GAGTCACAGCAGCTGGCGAGGGG - Intergenic
1133392011 16:5418355-5418377 GTGTCTGAGAAGATGCACAGGGG + Intergenic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1138105281 16:54284567-54284589 AAGTCCCAGCAGGTGCGGAGGGG + Exonic
1138646284 16:58427553-58427575 GATTCTCAGGAGAGGAAGAGTGG - Intergenic
1139491592 16:67288863-67288885 TGGTCACAGCAGATCCAGAGAGG - Exonic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1140468811 16:75203603-75203625 GGGTCACAGAAAATGCAGAGAGG + Intergenic
1141147519 16:81542136-81542158 GACTCTCAGTAGATGCTGAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141746929 16:85932114-85932136 GAGCCTCAGCTGCTGCAGAATGG + Intergenic
1142305947 16:89285751-89285773 GTGTCTCTGCAGAGGCAGGGTGG - Intronic
1142683033 17:1561725-1561747 GGGTCTGAGGACATGCAGAGGGG - Intronic
1142788054 17:2240734-2240756 GAGTCTCTGCTGACGCAGTGTGG + Intronic
1143917800 17:10306776-10306798 CAGTCTCAGCAGTGGCAAAGTGG - Intronic
1144688249 17:17241383-17241405 AAGTCTGAGCAGTTGCAAAGGGG - Intergenic
1145290179 17:21537619-21537641 AACACTCAGCAAATGCAGAGGGG + Intronic
1146833039 17:36086435-36086457 GATTCTGAGTTGATGCAGAGAGG - Intergenic
1147182789 17:38697181-38697203 GAGACTGTGCAGGTGCAGAGTGG - Intergenic
1147236124 17:39058874-39058896 GGGTGTCAGCAGCTGTAGAGAGG + Intergenic
1147732871 17:42614714-42614736 CAGGGCCAGCAGATGCAGAGAGG - Intronic
1148980960 17:51574551-51574573 GAGGGCCAGCAGAAGCAGAGTGG + Intergenic
1149103184 17:52930004-52930026 AAGTCTCAGCAGGTGCAAAGGGG + Intergenic
1149264474 17:54912432-54912454 GAGTCCCAGCACATCCAGAAGGG - Intronic
1149405310 17:56343676-56343698 GAGTCCCAGGAGAAGAAGAGAGG - Intronic
1149866416 17:60153690-60153712 GAGACTGAGCAAAGGCAGAGCGG + Intronic
1150003946 17:61458006-61458028 GCCTCTCAGCAGATGGGGAGAGG + Intronic
1151583249 17:74992131-74992153 GAGACTCAGCAAAGGGAGAGGGG - Intronic
1152503833 17:80733445-80733467 GAGTCTCAGCAGAGAAAGCGTGG - Intronic
1153484474 18:5582866-5582888 GAGCGTCAGCAGAGGCAGTGAGG + Intronic
1154096091 18:11416546-11416568 GAGGCTGAGCAGCTGCAGAGAGG - Intergenic
1157673797 18:49553005-49553027 GAATCACAGCAGATTCAGAGAGG + Intergenic
1157741689 18:50099039-50099061 GAGTCTCAGCAACTGCTTAGAGG + Intronic
1159267214 18:66097868-66097890 GAGTCTCTGAAGTTGCAGTGAGG + Intergenic
1159390706 18:67788909-67788931 GAATCTTAGCAAAGGCAGAGTGG + Intergenic
1160900170 19:1424041-1424063 CCGTCTCAGAAGATGCAGAAAGG - Intronic
1161153903 19:2722516-2722538 AAGTCTCCGCAGAGGCAGATGGG - Intronic
1163692554 19:18745460-18745482 CAGTCTCACCAGGTGCAGACAGG - Intronic
1165058118 19:33191725-33191747 GAGCCACAGGACATGCAGAGAGG - Intronic
1166703464 19:44895391-44895413 GAGGTGCAGCAGGTGCAGAGAGG + Intronic
925015423 2:520819-520841 GAGTCTCAGTGGATCCACAGGGG - Intergenic
925555731 2:5129978-5130000 GACTGTCAGCAGATGGAGGGAGG - Intergenic
925872762 2:8285250-8285272 GCGTCTCAGCACATGGGGAGAGG + Intergenic
926786125 2:16520077-16520099 GAGTCTCAGCAGAATCACAGGGG - Intergenic
928024280 2:27727405-27727427 TGCTCTCAGCAGAGGCAGAGGGG + Intergenic
930107426 2:47651088-47651110 GGGTCTCTGCAGATGCAGTAAGG - Intergenic
933250977 2:80028057-80028079 GAGGCTCAGAAGATGAAGTGTGG + Intronic
936516293 2:113183435-113183457 GAGGCCCAGCAGATGGAGTGTGG - Exonic
937455466 2:122037280-122037302 GATTTTCATCAGAGGCAGAGCGG + Intergenic
937588839 2:123590061-123590083 GAGACACAGCAGAAGGAGAGTGG + Intergenic
938783254 2:134604011-134604033 GAATCTCAGTGGATGCAGTGGGG - Intronic
938910753 2:135883765-135883787 TGCTCTCAGCAGTTGCAGAGAGG + Intergenic
940236490 2:151516460-151516482 GAGTCTCAGCAGATGCAGAGTGG - Exonic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
943290211 2:186061463-186061485 AAGTGTCAGCAGATTCATAGAGG + Intergenic
944763710 2:202842751-202842773 GAGTTTAAGCAGAAGAAGAGAGG - Intronic
945834973 2:214828531-214828553 GAGTATCAGAAGATTAAGAGAGG - Intergenic
946347033 2:219118942-219118964 GAGTTTCAGCAGATCCTGGGGGG + Intronic
946591520 2:221254504-221254526 GAGTATGTGCAGATGCAGGGAGG + Intergenic
946735593 2:222751357-222751379 GAATCACAGCAGATTCAGATAGG + Intergenic
947486951 2:230559262-230559284 GAGAAACAGCAGATGCAGAAAGG + Intergenic
948048146 2:234958986-234959008 GAGTGGCCGCAGATGCTGAGAGG + Intronic
948176778 2:235949839-235949861 GAGTCACAGCTCATGCAGAATGG + Intronic
948550443 2:238768671-238768693 AAGACACAGGAGATGCAGAGGGG - Intergenic
948737195 2:240016811-240016833 GACACTCAGCAGATGCCGACAGG + Intronic
948789940 2:240371979-240372001 AAGTCTCAGAAGACCCAGAGAGG - Intergenic
1169253844 20:4082830-4082852 GACTGTCAACAGAGGCAGAGTGG - Intergenic
1170470472 20:16663528-16663550 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1170926161 20:20726280-20726302 GAGGCTCACCAGAAGCAGATTGG + Intergenic
1171193711 20:23180538-23180560 GGGCCTCAGCAGCTGCTGAGTGG + Intergenic
1172390794 20:34563715-34563737 TAGGCTTAGGAGATGCAGAGTGG - Intronic
1174143642 20:48434960-48434982 GAGGCCCATGAGATGCAGAGGGG - Intergenic
1176024373 20:62978350-62978372 GTGTCTCAGCAGAGGGAGATGGG - Intergenic
1179294530 21:40049369-40049391 GAGTCACAGCAGGAGCAGAGGGG - Intronic
1181443191 22:22949214-22949236 GAATCCCAGGAGATGCAGAGAGG + Intergenic
1181852077 22:25756598-25756620 GACTCTCAGAAGATGAATAGTGG + Intronic
1182930084 22:34165317-34165339 TAGTCCCAGCAGTTGCACAGGGG + Intergenic
1183030789 22:35102903-35102925 GAGCCTCAGATGATTCAGAGTGG - Intergenic
1183546492 22:38456822-38456844 GAGGCTCAGGAGAGCCAGAGGGG - Intergenic
1183961621 22:41414678-41414700 GTGGCTCAGCAGCTGCAGAATGG + Intergenic
1184208856 22:43023510-43023532 GAGGCTCAGCAGAAGAAGGGGGG - Intergenic
1184687994 22:46105022-46105044 GAGGCTCAGGAGAGGCCGAGGGG - Intronic
1185159080 22:49212037-49212059 GAGTCTCTGCAGATGGATACAGG - Intergenic
949594668 3:5531270-5531292 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
949757564 3:7430779-7430801 TAGTCTCAGAAGATACAGATAGG + Intronic
949831485 3:8219629-8219651 GAGACTCAGCTGAGGCAAAGGGG + Intergenic
950897144 3:16463277-16463299 GAGTCTCAGAAGGAGCAGAGAGG - Intronic
952333517 3:32385806-32385828 GAGGCCCAGCAGAGGGAGAGCGG - Intergenic
952520256 3:34149825-34149847 GATTCTCAGCAGCTGAAGTGGGG + Intergenic
953898263 3:46821011-46821033 GAGTATCAGCAAATGCTGAAAGG - Intergenic
954807449 3:53228778-53228800 GATTCTCAGCAGAGACAGACTGG + Intronic
956105887 3:65818521-65818543 TAGCCACAGAAGATGCAGAGGGG + Intronic
956687721 3:71846402-71846424 GAGGCTCAGCAGCTGCTGAAAGG - Intergenic
959278136 3:104304157-104304179 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
960035780 3:113101907-113101929 TAGTCTCAGCTGACCCAGAGGGG + Intergenic
961632192 3:128309266-128309288 GAGACTGAGCAGGTGCAAAGAGG + Intronic
962611694 3:137082868-137082890 GATGCTCAGCAGATGCAAGGTGG - Intergenic
963083343 3:141414867-141414889 AAGTGTCAACAGAGGCAGAGAGG - Intronic
966839567 3:184077714-184077736 GAATCACAGCAGAGCCAGAGGGG + Intergenic
967094547 3:186166322-186166344 GATTGTCAGTAGATGTAGAGGGG - Intronic
969617445 4:8261995-8262017 GAGCCACAGCAGATGGAGGGGGG + Intergenic
971488960 4:27191085-27191107 GAATCACAGCAGATTCACAGAGG - Intergenic
972935486 4:44129338-44129360 GAGTCTCATTGGATGCAGTGGGG - Intergenic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
975019074 4:69465390-69465412 GAATCACAGCAGATTCAGGGAGG - Intergenic
975177822 4:71308569-71308591 GAGGGTGAGCAGAAGCAGAGGGG + Intronic
976878953 4:89894875-89894897 CAGTCTTAGCAGATTCAGTGTGG + Exonic
978617755 4:110613029-110613051 AACTCTCAGCGGAGGCAGAGAGG + Intergenic
979857198 4:125649361-125649383 GAATCACAGCAGATTCACAGAGG + Intergenic
981768647 4:148281071-148281093 AAGTCTCAGGAGATGAAGGGAGG - Intronic
983760967 4:171406167-171406189 GAATCACATCAGATGCACAGAGG - Intergenic
984017909 4:174447593-174447615 GAGAAACAGCAGATGCAGAAAGG - Intergenic
985552015 5:538515-538537 GGGTTTCAGGAGATGCACAGAGG + Intergenic
985861622 5:2476024-2476046 AAAACTCAGCAGAAGCAGAGGGG + Intergenic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
992748575 5:79842033-79842055 GAGACTCAGCAAATGTTGAGTGG - Intergenic
994850901 5:105053683-105053705 GAGGGTCAGCAGAAGCAGAGTGG - Intergenic
995785816 5:115826197-115826219 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
997369365 5:133348312-133348334 GAGTCTAAGCAGAGGCACTGGGG + Intronic
998857703 5:146409673-146409695 TAGTCTTTGAAGATGCAGAGAGG - Intergenic
1000769438 5:165334328-165334350 GAGTCTCAGCAGACCTAGATAGG + Intergenic
1001824916 5:174736629-174736651 GACTCTCAGCAGAAGCAGGATGG - Intergenic
1004962282 6:20803494-20803516 TATTCTCAGAAGATGCAGAGAGG + Intronic
1007750648 6:44068689-44068711 GGGTCTCAGCAGAGGCAGCAGGG + Intergenic
1007855369 6:44850029-44850051 AAGTCTGAGGAGTTGCAGAGTGG + Intronic
1008370125 6:50722519-50722541 GAGCCTCAGAAGATTCAGGGGGG - Intronic
1009820691 6:68797360-68797382 GAGTCTCAGCAGGTAAAGAATGG + Intronic
1010337622 6:74705257-74705279 GAGTTTCAGGAGTTGGAGAGAGG + Intergenic
1010338650 6:74721396-74721418 GACTCTCAGAAGTTGAAGAGAGG - Intergenic
1010395707 6:75389830-75389852 GAGTCTCAGGAGATGGGGATAGG - Intronic
1011221428 6:85058309-85058331 AAGTCTCAGAAGAAGCAGAAGGG + Intergenic
1012934361 6:105350506-105350528 GAGACACAGCAGATTCAGATAGG - Intronic
1019295896 7:274524-274546 GAATCACAGCAGATTCAAAGAGG - Intergenic
1019500004 7:1360080-1360102 GGGGCTCAGCAGAGGCAGAGAGG - Intergenic
1020391649 7:7664439-7664461 AAGTGTCAGCATATTCAGAGTGG - Intronic
1020608666 7:10368025-10368047 GAGGGTGAGCAGATGCAGGGTGG - Intergenic
1021530014 7:21633708-21633730 GAGTCTAAGAAGAGACAGAGAGG + Intronic
1021913589 7:25409984-25410006 GAATCTGAACAGATGCAGAAGGG + Intergenic
1022178734 7:27897778-27897800 GAGTCTGTTCAGGTGCAGAGAGG - Intronic
1022413231 7:30155604-30155626 GAGACTCTGCGGATGTAGAGGGG - Intronic
1023105837 7:36762559-36762581 GGGGCTCAGCAGATTCAGAGAGG - Intergenic
1023477876 7:40600480-40600502 GAGATTAAGCAGATGCACAGAGG - Intronic
1025149918 7:56539906-56539928 GAGTCTCACTCTATGCAGAGGGG - Intergenic
1025714316 7:63941108-63941130 GAGGGTTAGCAGAAGCAGAGTGG + Intergenic
1026152376 7:67799092-67799114 GAGCATCAGAAGATGCTGAGAGG - Intergenic
1030422310 7:109323130-109323152 AAATCACAGCAGATTCAGAGAGG - Intergenic
1031698292 7:124888892-124888914 GAGCCTCAGGAGAGGGAGAGGGG - Intronic
1033812899 7:145037705-145037727 GAGACTAAGCAAATGAAGAGGGG + Intergenic
1034575398 7:151992641-151992663 GAGTCTTTGCAGATGCAATGAGG - Intronic
1034710959 7:153191158-153191180 GAATCGCAGCATTTGCAGAGAGG - Intergenic
1035565823 8:640295-640317 GTGTGTCAGCAGCTCCAGAGAGG - Intronic
1036607364 8:10319322-10319344 CAGTCTCAGCAGCTGAAGGGTGG - Intronic
1039612586 8:38931361-38931383 GCGTCTGAGCAGATACAAAGTGG - Intronic
1041746331 8:61212398-61212420 ATGCCTCAGCAGATGCAGCGGGG + Intronic
1041753541 8:61288159-61288181 GAGGCTCGGCAAATACAGAGGGG - Intronic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1045933586 8:107654451-107654473 GAATCACAGCAGATTCAGAGAGG + Intergenic
1047218927 8:122902961-122902983 GAGTCTCACCAGCTCCCGAGTGG - Intronic
1047704898 8:127488556-127488578 GAGTCTCAGCGGAGGCTGAGTGG - Intergenic
1048346598 8:133580540-133580562 GAGGCTCTGCAGAAGCAGTGAGG - Intergenic
1049207044 8:141368427-141368449 GAGTATCAGCAGAAGCACACGGG - Intergenic
1049787386 8:144457505-144457527 GTGTATCAGCATCTGCAGAGGGG - Intronic
1050099742 9:2106237-2106259 GAGTTTTAGCAGATCCAGAGAGG + Intronic
1051322025 9:15914941-15914963 GAGGGTGAGCAGAAGCAGAGTGG - Intronic
1052098020 9:24408630-24408652 GAGTGTCAGCCGAAGCAGGGTGG + Intergenic
1052346767 9:27417592-27417614 GATTCTCAGCAGAAGCTGAGAGG - Intronic
1053023557 9:34712395-34712417 GAGTCTCAGGAGGAGAAGAGAGG - Intergenic
1053070912 9:35101421-35101443 GAGTCTATGCAGATGCAGGTGGG - Exonic
1054778062 9:69140463-69140485 GTGTGTCAGCAGGTGCAGCGTGG + Intronic
1055077936 9:72236508-72236530 AAATCCCAGCAGATGCAGAAAGG - Intronic
1056567450 9:87786786-87786808 GAGGCTCTGCAGATGCTAAGTGG + Intergenic
1056852454 9:90095937-90095959 GTGTCTCAGCAGCGACAGAGCGG - Intergenic
1057262857 9:93595600-93595622 GTGTGTCTGCACATGCAGAGAGG - Intronic
1058884598 9:109313733-109313755 GAGTCCCAGGAAATGTAGAGAGG + Intronic
1059370332 9:113825626-113825648 GAGTGTCAACAGAGGCTGAGTGG + Intergenic
1060516429 9:124268957-124268979 GAGTCTCGGCAGATGCGGGAAGG + Intronic
1060970885 9:127737198-127737220 GGGTCACAGCAGCAGCAGAGTGG - Intergenic
1062310598 9:135933862-135933884 GAAGGTCAGCAGATGCAGAAAGG + Intronic
1062590376 9:137271920-137271942 GGGTCTCAGCAGGTGAAGAGGGG - Intronic
1187284354 X:17889635-17889657 GAGACTCAGCTAAAGCAGAGAGG + Intergenic
1189556310 X:42148862-42148884 CAGTCTCCTCAAATGCAGAGTGG - Intergenic
1190966864 X:55309141-55309163 GAGACTGAGCAGATCCAGCGTGG - Intergenic
1191788947 X:64947896-64947918 GAATCACAGCAGATTCAGGGAGG - Intronic
1193010558 X:76670876-76670898 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1195522429 X:105846615-105846637 GACTCTTAGCAAATTCAGAGAGG - Intronic
1195844358 X:109209872-109209894 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1197134138 X:123041431-123041453 AAGGATCAGCAGTTGCAGAGGGG + Intergenic
1199171661 X:144740686-144740708 GAGGGTCAGGAGAAGCAGAGGGG - Intergenic
1200258328 X:154597708-154597730 GACTCTCAGCAAAGCCAGAGGGG - Intergenic
1200842815 Y:7800845-7800867 GAGTCTCAGAAGGAGCAGAGTGG - Intergenic