ID: 940237316

View in Genome Browser
Species Human (GRCh38)
Location 2:151525444-151525466
Sequence TTGCCAGGTGGTTCTAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940237316_940237321 -6 Left 940237316 2:151525444-151525466 CCAACACTAGAACCACCTGGCAA 0: 1
1: 0
2: 0
3: 7
4: 141
Right 940237321 2:151525461-151525483 TGGCAATCTTCGGAGAACCTGGG 0: 1
1: 0
2: 1
3: 19
4: 122
940237316_940237320 -7 Left 940237316 2:151525444-151525466 CCAACACTAGAACCACCTGGCAA 0: 1
1: 0
2: 0
3: 7
4: 141
Right 940237320 2:151525460-151525482 CTGGCAATCTTCGGAGAACCTGG 0: 1
1: 0
2: 0
3: 4
4: 68
940237316_940237322 0 Left 940237316 2:151525444-151525466 CCAACACTAGAACCACCTGGCAA 0: 1
1: 0
2: 0
3: 7
4: 141
Right 940237322 2:151525467-151525489 TCTTCGGAGAACCTGGGTAGAGG 0: 1
1: 0
2: 0
3: 9
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940237316 Original CRISPR TTGCCAGGTGGTTCTAGTGT TGG (reversed) Intronic
900398749 1:2464201-2464223 TTTCCATGGGGTTCGAGTGTTGG + Intronic
901681997 1:10918468-10918490 CTCCCAGGTGATTCTAGGGTTGG + Intergenic
907952098 1:59193616-59193638 TAGCCAGGTGGTTCTGGCTTGGG + Intergenic
911741326 1:101389088-101389110 TTTCCAGGTGCTGCTAGTCTGGG + Intergenic
913215755 1:116618931-116618953 TCCCCAGGTGATTCCAGTGTAGG - Intronic
916015682 1:160748070-160748092 TTTCCAGGAGGTTGTTGTGTTGG + Intronic
917417859 1:174829992-174830014 TGGCTAGGTGGTTCTTCTGTTGG + Intronic
919305974 1:195838376-195838398 TTCCCAGGTGGTTCTTGGTTTGG + Intergenic
922194207 1:223345801-223345823 CAGCCAGGGGTTTCTAGTGTAGG - Intronic
923316934 1:232789489-232789511 CCTCCAGGTGATTCTAGTGTGGG - Intergenic
1062847808 10:721293-721315 TTGCCAGCTGGTTGGAATGTGGG - Intergenic
1064599475 10:16978632-16978654 TAGCCAGTTGGATCTTGTGTAGG + Intronic
1069911519 10:71762578-71762600 TTGCCATGGGGTTCTGCTGTCGG - Intronic
1072418598 10:95270298-95270320 CTGGCAGGTGGATCGAGTGTGGG - Intronic
1074782300 10:116810742-116810764 TTTCCAGGTGATTCTGATGTAGG + Intergenic
1076145654 10:128117991-128118013 TTGCCTGGTGGCTACAGTGTGGG + Intronic
1085406789 11:76268103-76268125 TTGCAAGGTGGTTGTATTCTTGG + Intergenic
1087241097 11:95781246-95781268 TTGCCAGGTGGCACTAAGGTGGG - Intronic
1088601652 11:111484186-111484208 TTGTAAGGTGGGTCTGGTGTTGG - Intronic
1093097714 12:14990796-14990818 CTTCCAGGTGTTTCTAGTTTTGG - Intergenic
1093573404 12:20695667-20695689 TTGCCAGGTGGGGAGAGTGTGGG - Intronic
1095050393 12:37548827-37548849 TTTTCCGGTGGTTCTAGTTTGGG + Intergenic
1097222085 12:57456945-57456967 TTGCCAGGTGGTTGTTGGGTTGG - Exonic
1097716100 12:62967948-62967970 TTGCAATGTGGATCTAGAGTTGG + Intergenic
1099233626 12:80056267-80056289 GTGCCAGGCTGTTCGAGTGTAGG - Intergenic
1101574753 12:105987175-105987197 TGGCCAGGTGGTTCTTCTGCTGG + Intergenic
1103015138 12:117488384-117488406 TTGCAGGTTGGTTCTAGTTTGGG - Intronic
1105219485 13:18312407-18312429 TCCCCAGGTGATTCCAGTGTAGG - Intergenic
1106536995 13:30654554-30654576 TCCCCAGGTGATTCCAGTGTGGG + Intronic
1108259299 13:48641016-48641038 TTACCAGGTGAATCTAGTGGAGG + Intergenic
1114955933 14:27819309-27819331 TTGCCATGTGGATCAAGAGTAGG - Intergenic
1115171790 14:30516624-30516646 TTTCCTGGTTGTTCTAGTCTAGG + Intergenic
1116189936 14:41651497-41651519 TTACCAGGTAGTTGTAGTGTAGG + Intronic
1128229729 15:66026013-66026035 TCCCCAGGTGATTCTAATGTGGG - Intronic
1131347801 15:91667057-91667079 TATCCAGGTGGTGCTAGTGATGG + Intergenic
1134915792 16:18069836-18069858 TTCCCAGGTGGTTCTCTTTTAGG + Intergenic
1135225853 16:20657249-20657271 TTGCCTTTTGGTTCTATTGTTGG + Intronic
1135794765 16:25431283-25431305 TTGGAAGTTGGTTCTAGGGTTGG + Intergenic
1135815063 16:25625019-25625041 TTCCCAGGTGATGCTAATGTTGG - Intergenic
1135908177 16:26533194-26533216 TTGCCAAGTGGTTCTTGGGGTGG - Intergenic
1139120269 16:64007731-64007753 TTGCCAGATGTTTCCAGTGGAGG - Intergenic
1141394965 16:83696474-83696496 GTTCCAGGTGGATCCAGTGTGGG - Intronic
1141457351 16:84152143-84152165 TAGCCAGGTGGTTGCAGTGATGG + Intronic
1142024160 16:87803563-87803585 CAGCCAGGTGGTTCTTGTGCAGG - Intergenic
1145960699 17:28885073-28885095 TTTGCAGGTGTTTCAAGTGTAGG + Intronic
1147632222 17:41939475-41939497 ATGCCAGATGCTGCTAGTGTGGG + Intronic
1149315308 17:55432899-55432921 TGGCCTGGTGGATCTAGTGCAGG + Intergenic
1150531639 17:65989584-65989606 TTGTAAGATGGTTCTGGTGTTGG - Intronic
1151807849 17:76417654-76417676 CTGCCAGGTGGTTTTAGTGATGG - Intronic
1152526639 17:80891873-80891895 TCGCCTGGCGGTTCTAGTGCAGG + Intronic
1153020924 18:628505-628527 TTGCCACGAGGGTCAAGTGTAGG + Intronic
1157348636 18:46864293-46864315 ATTGCAGGTGGTTGTAGTGTTGG - Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1161650507 19:5481581-5481603 TGGACAATTGGTTCTAGTGTGGG - Intergenic
1162022649 19:7874675-7874697 GTGCCAGGTGGTTGTGGTGGGGG - Intergenic
1162150562 19:8642489-8642511 TAGCCAGGCGGTTCTTCTGTCGG + Intergenic
1165631592 19:37306086-37306108 TTTCCCGGTGGTTCCAGTTTGGG - Intergenic
1166034290 19:40156149-40156171 TTGCCAGATGGTTCTATGTTAGG - Intergenic
1167114338 19:47480145-47480167 TTGCCGGGTGGGGCTAGGGTGGG - Intronic
927750089 2:25660950-25660972 AAGCCTGGTGGATCTAGTGTTGG - Intronic
927863134 2:26572839-26572861 CTGCCCGATGGTTCCAGTGTGGG + Intronic
929331356 2:40685088-40685110 TTGCCATGTTGTTCTAGAGATGG - Intergenic
929746880 2:44668227-44668249 TGGACAGGTGGCTCTAGTGATGG - Intronic
931380188 2:61745548-61745570 TTACCAGTTGATTCTAGAGTTGG + Intergenic
934481351 2:94648779-94648801 TTGCCATGTGGATCAAGAGTAGG + Intergenic
934767264 2:96886639-96886661 TTGCCAGGAGTTTTTAGTGACGG - Intronic
935419367 2:102851406-102851428 TTGTGAGGTGGTTGTAGTGGTGG + Intergenic
935859414 2:107311839-107311861 TTCCCAGGTGGTGCTGGTCTGGG + Intergenic
936897976 2:117450249-117450271 TTGACAGGTGATTCTAATTTGGG - Intergenic
938645128 2:133322804-133322826 TCTCCAGGTGGTACTAGTGCTGG - Intronic
939666105 2:144953333-144953355 TTCCCAGATGATACTAGTGTGGG - Intergenic
940237316 2:151525444-151525466 TTGCCAGGTGGTTCTAGTGTTGG - Intronic
942231494 2:173864611-173864633 TTGCCAGGGGGTTGAAGTGCTGG - Intergenic
944254880 2:197615490-197615512 TTGGCATTTGGTTCTAATGTAGG + Intronic
944979672 2:205102128-205102150 TAGCTAGGCGGTTCTAGGGTTGG - Intronic
946209626 2:218137163-218137185 TAGGCAGGTGGTTCTAGCCTTGG - Exonic
946534281 2:220609234-220609256 TTGCCATGTGGTTATAGGTTTGG + Intergenic
947438735 2:230097661-230097683 TTGCCAGGTGTTAGTAGTGACGG - Intergenic
1172917218 20:38452097-38452119 GTGTCAGGTGGTTCTTGGGTAGG - Intergenic
1176231205 20:64034009-64034031 GAGCCAGCTGGTTCTTGTGTAGG + Intronic
1176927827 21:14771517-14771539 TTGCCAGTTGGTTCTTTTGCTGG - Intergenic
1177722519 21:24926920-24926942 TTGGGAGGTGGTTGTATTGTAGG + Intergenic
1180817086 22:18797267-18797289 TCCCCAGGTGATTCCAGTGTAGG - Intergenic
1181203275 22:21231612-21231634 TCCCCAGGTGATTCCAGTGTAGG - Intergenic
1183057935 22:35318468-35318490 TTGCCGGGCGTTTCTGGTGTTGG + Intronic
1203223644 22_KI270731v1_random:63812-63834 TCCCCAGGTGATTCCAGTGTAGG + Intergenic
1203267185 22_KI270734v1_random:22988-23010 TCCCCAGGTGATTCCAGTGTAGG - Intergenic
951478731 3:23136323-23136345 TTGCTAGGTGGTGGTAGTGATGG - Intergenic
951503954 3:23420659-23420681 TTTACAAGTGGTTCTGGTGTAGG - Intronic
953877170 3:46673039-46673061 TTTTGAGGTTGTTCTAGTGTTGG + Intronic
954762520 3:52886795-52886817 GTGTCAGTTGATTCTAGTGTTGG - Intronic
956312973 3:67902545-67902567 TTGCCAGGTGGTTATCATTTTGG - Intergenic
956436953 3:69243481-69243503 ATGCCAGGTTGTGCTGGTGTTGG + Intronic
960648654 3:119920635-119920657 TTAGCTGGTGGTCCTAGTGTTGG + Intronic
963348238 3:144122173-144122195 TTGACAGGTGGTTCTTATGGTGG + Intergenic
965724046 3:171695158-171695180 TTTCCAGGTTGTTATAGTGTAGG + Intronic
974361402 4:60885306-60885328 TTGCCTGGTGGTTCTTGAATAGG - Intergenic
977262475 4:94814457-94814479 TTGCTTGGTGGTTAGAGTGTGGG + Intronic
977313772 4:95419176-95419198 TCCCCAGGTGGTTCTTTTGTTGG + Intronic
981583085 4:146270611-146270633 CTCCCAGGTGATTCTAATGTGGG + Intronic
982274461 4:153625093-153625115 TTGCCTGATGATTCCAGTGTGGG + Intronic
984513468 4:180708814-180708836 TAGCCAGGTGTGTCTGGTGTAGG - Intergenic
988821751 5:34893347-34893369 TTGCCAGGTGAATGTATTGTGGG - Intronic
992654868 5:78898977-78898999 TTGCAAGATGGATCTAGTGGTGG + Intronic
994241237 5:97423965-97423987 TTGCCAGGGGCTGCTGGTGTTGG - Intergenic
995703335 5:114959496-114959518 TTTCCAGGTGGGTATAGTGGAGG - Intergenic
999393442 5:151211427-151211449 TTTCCAGGTGGCTCTAGTACAGG - Intronic
999401340 5:151266724-151266746 TTACCAGGTGGATTTAGTTTTGG + Exonic
1000103698 5:158038631-158038653 TAGCCAGGTGGTGGTGGTGTGGG + Intergenic
1000233066 5:159333162-159333184 TTGGCAGGTTGTTCTAATGTGGG + Intergenic
1001204606 5:169750573-169750595 TACCCAGGTGGTTCTTGTCTGGG + Intronic
1002943099 6:1734815-1734837 TTGCGAGGTGGTGCTACTGAGGG + Intronic
1004790608 6:19022094-19022116 ATGCCAGTTGATTCTAATGTAGG - Intergenic
1007183893 6:39951023-39951045 TTGCCAGGTGTATATTGTGTAGG + Intergenic
1013571304 6:111429358-111429380 TTGTAAGGTGGTTCTGGTGGTGG - Intronic
1014973656 6:127850351-127850373 TTGCCAGATTGTTCTACTTTTGG - Intronic
1021066004 7:16173200-16173222 CATCCAGGTGGTTCTAGTGCAGG + Intronic
1022283808 7:28935943-28935965 TTGCCATGTGCTTTTAGGGTAGG - Intergenic
1022630430 7:32079511-32079533 TGGCCAGGTAGTTCTTCTGTTGG + Intronic
1023513487 7:40977859-40977881 CTGCCAGGAGATTCTAGTCTTGG + Intergenic
1027129224 7:75579297-75579319 TTTCCAGCTGTTTCTGGTGTTGG + Intronic
1027379131 7:77586696-77586718 TTGCCAAGTAGTTCTACTGTGGG - Intronic
1027575115 7:79922038-79922060 TGGCCAGGTTGTTACAGTGTGGG - Intergenic
1033427911 7:141262104-141262126 TTGCAAACTGGTTCTAGTTTTGG - Intronic
1034056492 7:148040473-148040495 TTTCTAGGTGGTTCTAATGTCGG + Intronic
1034836405 7:154355667-154355689 GTGACAGGTGGATCTAGTTTTGG + Intronic
1035743031 8:1943478-1943500 ATTCCAGATGGTTCTAGCGTGGG - Intronic
1037674316 8:21041096-21041118 TTCCTAGGTAGTGCTAGTGTTGG - Intergenic
1039461333 8:37747881-37747903 CGGCCAGGTGGTCCTAGTGCTGG - Intronic
1039767267 8:40642598-40642620 TTGCCAGGTTGTTCTTATGAAGG - Intronic
1042369199 8:67971436-67971458 TCCCCAGGTGATTCTAATGTGGG + Intronic
1042714974 8:71762666-71762688 TTTCCAAGTGATTCTAATGTTGG - Intergenic
1045301029 8:100910260-100910282 TCTCCAGGTGATTCTAGTTTAGG + Intergenic
1048210740 8:132452473-132452495 TTGCCAGAAGGTTCCAGTGGAGG - Intronic
1048820387 8:138374957-138374979 TTCCCAGGTTGTTCTTTTGTGGG - Intronic
1049350069 8:142159690-142159712 TTTCCAGGTGGTTCCGGTGGAGG - Intergenic
1049350125 8:142159886-142159908 TTTCCGGGTGGTTCCAGTGGAGG - Intergenic
1051747648 9:20310051-20310073 CAGCCAGGTGTTTCTAGTTTTGG + Intergenic
1052400736 9:27997227-27997249 CTGCCAGGTGGTACAAATGTAGG - Intronic
1053676488 9:40435327-40435349 TTGCCATGTGGATCAAGAGTAGG - Intergenic
1053926258 9:43061443-43061465 TTGCCATGTGGATCAAGAGTAGG - Intergenic
1054287232 9:63189567-63189589 TTGCCATGTGGATCAAGAGTAGG + Intergenic
1054289555 9:63270850-63270872 TTGCCATGTGGATCAAGAGTAGG - Intergenic
1054387586 9:64575397-64575419 TTGCCATGTGGATCAAGAGTAGG - Intergenic
1054508134 9:65940967-65940989 TTGCCATGTGGATCAAGAGTAGG + Intergenic
1057763120 9:97892161-97892183 GTGCCAGGTGGGGCTGGTGTTGG - Intergenic
1061266889 9:129511389-129511411 TTGCCAGTTGGTGGTTGTGTGGG - Intergenic
1062531846 9:137005142-137005164 TGGCCAGGTTGGTCTCGTGTAGG - Intergenic
1194415145 X:93602624-93602646 TTACCAATTGTTTCTAGTGTTGG - Intergenic