ID: 940241545

View in Genome Browser
Species Human (GRCh38)
Location 2:151568336-151568358
Sequence CCTCCTGGGCAGTGTGCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 382}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940241540_940241545 -8 Left 940241540 2:151568321-151568343 CCAGTATCCTAGCAGCCTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 167
Right 940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG 0: 1
1: 0
2: 1
3: 47
4: 382
940241537_940241545 4 Left 940241537 2:151568309-151568331 CCCATACCTGGTCCAGTATCCTA 0: 1
1: 0
2: 0
3: 5
4: 76
Right 940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG 0: 1
1: 0
2: 1
3: 47
4: 382
940241539_940241545 -2 Left 940241539 2:151568315-151568337 CCTGGTCCAGTATCCTAGCAGCC 0: 1
1: 0
2: 0
3: 16
4: 84
Right 940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG 0: 1
1: 0
2: 1
3: 47
4: 382
940241538_940241545 3 Left 940241538 2:151568310-151568332 CCATACCTGGTCCAGTATCCTAG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG 0: 1
1: 0
2: 1
3: 47
4: 382
940241535_940241545 22 Left 940241535 2:151568291-151568313 CCAGGCATGTGGGTGAAACCCAT 0: 1
1: 0
2: 0
3: 14
4: 195
Right 940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG 0: 1
1: 0
2: 1
3: 47
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940241545 Original CRISPR CCTCCTGGGCAGTGTGCAGC AGG Exonic
900186163 1:1334245-1334267 CCTCCTGGCCAATGTGCAGGTGG + Exonic
900200382 1:1402343-1402365 CCCCCAGGCGAGTGTGCAGCTGG - Intronic
900351064 1:2234884-2234906 CCTCCTGAGCAGTGGTCACCAGG + Intronic
900553060 1:3266040-3266062 CATCCAGGGCGGTGTGCGGCCGG + Intronic
900598038 1:3491268-3491290 CCCCATGGGCAGTGTGTTGCTGG - Intronic
900764468 1:4494684-4494706 CGTCCTGGGCAGTCTGCACCAGG + Intergenic
902334463 1:15747094-15747116 GCTCCTGGGCTGTTTGAAGCAGG - Intronic
903259587 1:22124159-22124181 CCACCTGGGCAGGTAGCAGCGGG + Intronic
903332658 1:22603934-22603956 ACTCAAGGGCAGTGTCCAGCTGG - Intergenic
903575479 1:24337178-24337200 ACACCTGGGCAGTGGGCAGGAGG + Intronic
903785810 1:25860508-25860530 CCTCTTGCCCAGTCTGCAGCAGG + Intergenic
904346526 1:29875602-29875624 CTTCCTGGGCAGGTTGCTGCAGG - Intergenic
904612404 1:31732746-31732768 ACACCTGGGCAGGGTGCAACGGG + Intronic
905741453 1:40374362-40374384 CCTACTGGGCTTTCTGCAGCTGG + Intronic
905811294 1:40915357-40915379 CTTCCTGGGCAGAGTGATGCAGG + Intergenic
906033905 1:42739234-42739256 GCTCCTGGGCAGATTGCAGGTGG + Intronic
906447689 1:45917512-45917534 CCTCCACGGCAGTGGGCGGCTGG - Intronic
906699385 1:47846938-47846960 CCTCCTGGGCAGTGATCTGCGGG + Intronic
906821205 1:48932073-48932095 CCACCTGAGCAGTATGCAGTGGG + Intronic
907461861 1:54609903-54609925 CCTCGAGGCCAGTGTTCAGCAGG + Exonic
907703974 1:56817110-56817132 CCACCTGGGCATTGTGGACCAGG - Intronic
907797013 1:57728004-57728026 TCTCCTGCCCAGTGTTCAGCAGG + Intronic
908794314 1:67816303-67816325 GCTCCTGGGCAGAGTGCAAAGGG + Intronic
911088297 1:93997992-93998014 CTTCCCAGGCAGTGTGCAGAGGG - Exonic
912306370 1:108571724-108571746 CCTCCTAGGAAGTGGGCGGCAGG - Intronic
913169995 1:116223019-116223041 CAGCCTGGGCAATGTGCAGTCGG - Intergenic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
913319774 1:117580043-117580065 CATCCTGGAGGGTGTGCAGCTGG + Intergenic
913961367 1:143340100-143340122 CCTTATGGGCAGTGTCCTGCAGG + Intergenic
914055720 1:144165673-144165695 CCTTATGGGCAGTGTCCTGCAGG + Intergenic
914123426 1:144800689-144800711 CCTTATGGGCAGTGTCCTGCAGG - Intergenic
915209070 1:154293151-154293173 CCTCCTGAGTAGTGAGTAGCTGG - Intergenic
915637669 1:157197856-157197878 CCTGGTGGGCAGTGGTCAGCAGG - Intergenic
915700227 1:157785057-157785079 CCTTCTTGGGAGTCTGCAGCAGG - Intergenic
916056044 1:161069528-161069550 CCTCCTGGCCTGAGTGCTGCAGG + Exonic
918046200 1:180942402-180942424 TCTCCTAGGCAGAGTGAAGCAGG + Intronic
919977672 1:202623350-202623372 CCCCCTGGGCTGGGAGCAGCTGG - Intronic
919979041 1:202630948-202630970 CATCCTGGGCTGTGTTCTGCAGG - Intronic
920351911 1:205343394-205343416 CCGCCCGGGCTGTGGGCAGCCGG + Exonic
920678967 1:208058506-208058528 CATCCCGGGCAGTGAGCAGCAGG - Intronic
922801425 1:228366393-228366415 CCTCCAGGACAGCGTCCAGCTGG + Exonic
923136897 1:231127761-231127783 CCTCCTGGGCCCTGGGCACCGGG - Intergenic
923421100 1:233816024-233816046 CTTCCTGGGCAGGTTGCTGCAGG + Intergenic
924041987 1:239992788-239992810 CCTCCTGGGGCGTCTGCAGATGG + Intergenic
924662607 1:246035417-246035439 CATCCTGGGAACTGTGCCGCGGG - Intronic
924940095 1:248807206-248807228 CCTCATGGGCACTTTGCAGAAGG - Intergenic
1063600920 10:7480571-7480593 CCTGATGGGCAGTGTTCAGACGG + Intergenic
1063759163 10:9052732-9052754 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1064102944 10:12478750-12478772 TCTCTTGGGCACTGTGCAGTAGG + Intronic
1064265971 10:13825685-13825707 TGTCCTGGGCAGGGTGGAGCAGG + Intronic
1064774215 10:18757444-18757466 CCTCCTGAGTAGTGAGTAGCTGG + Intergenic
1065835782 10:29656829-29656851 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
1067029816 10:42872497-42872519 CCTTATGGGCAGTGTCCTGCAGG + Intergenic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1068266570 10:54657164-54657186 ACTCCTGGCCATAGTGCAGCTGG - Intronic
1068351071 10:55845921-55845943 CCTCCTAGGCAGTGTGTGGGGGG - Intergenic
1068370595 10:56109268-56109290 CCTCCTGAGTAGTGAGCAGCTGG + Intergenic
1069063925 10:63922905-63922927 CCTCCTGCTCAGTCTGCAGCAGG - Intergenic
1070689840 10:78516412-78516434 CCTCCTGCCCTGTGTGCAGCTGG + Intergenic
1071056221 10:81510840-81510862 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1071495633 10:86165743-86165765 CCTCCTGGGAAGTGGTCAGTGGG - Intronic
1071601447 10:86960472-86960494 CCTCCCGGGCAGTGGTCACCAGG + Intronic
1072273290 10:93798721-93798743 CCTTTTGGGCATTCTGCAGCAGG - Intergenic
1072278987 10:93848935-93848957 CATTCTGTGCAGTGAGCAGCAGG + Intergenic
1072291389 10:93968885-93968907 ACTCATGGGCTGTCTGCAGCTGG - Intergenic
1073977362 10:109116692-109116714 CTTCCTGGGCAGCAAGCAGCAGG - Intergenic
1074986795 10:118666495-118666517 CTTCCTGGGCAGTGGTCCGCGGG + Intergenic
1075085963 10:119414513-119414535 CTTCCTAGACAGTGTGCAGGAGG - Intronic
1075168508 10:120091458-120091480 CTGTCTGGCCAGTGTGCAGCTGG + Intergenic
1075307892 10:121384078-121384100 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1075323111 10:121508276-121508298 CATCCTTGGCAGTGAGCAGAGGG - Intronic
1075445180 10:122508102-122508124 ACTCCTGGGAAGTGTGCACTTGG + Intronic
1075557439 10:123443844-123443866 GCTCCTGGGCTGTGGCCAGCAGG + Intergenic
1075668296 10:124245968-124245990 CTTCCTGGGCAGTGACCATCAGG - Intergenic
1075710923 10:124530149-124530171 CCCCCAGGGCAGTGTGCATCCGG + Intronic
1076180290 10:128401823-128401845 CCTCCTGGGCATGGAGCAGGAGG + Intergenic
1076514198 10:131033925-131033947 GCTCCTGGGGAATGTGGAGCAGG + Intergenic
1076763144 10:132615683-132615705 CCTGCTGGAGAGTGGGCAGCTGG + Intronic
1076779186 10:132714585-132714607 CCTCCTGGGCCTGGTGCTGCCGG - Intronic
1076854114 10:133106850-133106872 GCTCCTGGGCAGTGTTTATCTGG + Intronic
1076997738 11:307173-307195 GCTGCTGGGCTGTGTGGAGCGGG + Intergenic
1077002029 11:328267-328289 GCCTCTGGGCAGTGGGCAGCGGG + Intergenic
1077225596 11:1437865-1437887 CTTCCTGGGCAGTGTGGGGAGGG + Intronic
1077228924 11:1450134-1450156 CCTCCTGTGCCGTGTGCATGCGG + Intronic
1077232471 11:1464094-1464116 CTTCCTGAGCAGTGGGGAGCTGG - Intergenic
1077240423 11:1507817-1507839 CCTGCTGGGCTCTGTGAAGCTGG - Intergenic
1077252673 11:1567500-1567522 GCTCCTGGGCAGGGAGGAGCTGG - Intronic
1077429883 11:2511140-2511162 CCTCCTGGGTTGGGGGCAGCAGG + Intronic
1079107039 11:17578369-17578391 CCTGCTGGGCAGGCAGCAGCTGG - Exonic
1083121296 11:60515159-60515181 GATCCTGGTCACTGTGCAGCAGG + Intergenic
1083627544 11:64079267-64079289 CCACCTGTGCTGTGTGCAGCTGG + Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1083757140 11:64797639-64797661 CCTCCTGGACCGACTGCAGCAGG + Exonic
1083857246 11:65399377-65399399 CCGCCTGGACAGTGGTCAGCAGG + Intronic
1083859727 11:65413706-65413728 CCTCCTGGGCAACGTGGGGCTGG - Intergenic
1084708582 11:70830147-70830169 CCTCCAGGGCAGTTTTCATCTGG + Intronic
1085272868 11:75280679-75280701 CCTCCTGGGAGGCGTTCAGCAGG - Intronic
1087118092 11:94544898-94544920 CCTCCTCGGCAGTGTGCGCCTGG - Exonic
1087833961 11:102851189-102851211 TTTCCTGGGCAGTTTGCCGCAGG + Intergenic
1090767436 11:129888603-129888625 GCTTCTGGGCAATGTGCAGAGGG + Exonic
1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG + Exonic
1092091792 12:5809695-5809717 CTTCCTGTGCACGGTGCAGCTGG + Intronic
1095535267 12:43238498-43238520 TTTCCTGGGCTGTGTGCTGCAGG + Intergenic
1095957251 12:47813788-47813810 CAGCCTTGGCAGTGTGCAGGGGG + Intronic
1096475434 12:51906709-51906731 CTTCCTGGCCGTTGTGCAGCTGG - Intergenic
1098110126 12:67112892-67112914 TCTCCTGGGCACTGTGAAGAGGG + Intergenic
1098437470 12:70483240-70483262 CATTCTGTGCAGTGAGCAGCAGG - Intergenic
1102123165 12:110458943-110458965 CCTCCTGGGAGGTGTTCAGCAGG + Intronic
1102196504 12:111029126-111029148 CTTCCTGGGCACTGAGCAGGTGG + Intergenic
1103281495 12:119761516-119761538 ACTCCTGGGCTGTGTGCAAGAGG + Intronic
1104296836 12:127523523-127523545 CCTCCTTGGGAATGTGCTGCTGG - Intergenic
1104559975 12:129834611-129834633 GTCCCTGGGCAGTGAGCAGCAGG + Intronic
1104747577 12:131219800-131219822 CCTCCCTGGCTGTGTCCAGCAGG - Intergenic
1104866671 12:131960059-131960081 CCTCCTGGGCTCTGGGCAGCTGG + Intronic
1106012486 13:25838125-25838147 CCTCCTGTGCTGTGTGCTGGTGG + Intronic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1106906351 13:34413613-34413635 CCACCTTGGCAGTGAGCAGCAGG - Intergenic
1108473078 13:50787236-50787258 CCTCCTGGGCATTATTAAGCAGG - Intronic
1109227770 13:59717338-59717360 CCTACTTGACAGTGTGCAGATGG + Intronic
1109292027 13:60488049-60488071 CTTACTGTGCAGTGAGCAGCAGG - Intronic
1109522129 13:63527452-63527474 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1113074619 13:106455386-106455408 TCCCCTGGGCAGTGGGCAGTAGG - Intergenic
1113870530 13:113556924-113556946 CCACCTGGGGAGAGAGCAGCTGG + Intergenic
1117171715 14:53107427-53107449 CATCCTGGGCAGGATGGAGCAGG + Intronic
1118091441 14:62484694-62484716 CCTCCTCTGCATTGTGAAGCAGG + Intergenic
1118466674 14:66037617-66037639 CCTCCTAGCTGGTGTGCAGCTGG - Intergenic
1120983693 14:90314030-90314052 CCTCAGGGGCGGTCTGCAGCTGG - Intronic
1121417146 14:93787593-93787615 CCTCCCAGCCAGTGCGCAGCCGG + Intronic
1121709990 14:96030621-96030643 GCTCTTGGGCAGTGTGGTGCGGG - Intergenic
1121776330 14:96593306-96593328 CCCCCTGGGCAGGATGCTGCTGG - Intergenic
1122898363 14:104771655-104771677 TGTCCTAGGCTGTGTGCAGCTGG - Intronic
1122922885 14:104887207-104887229 CCTCCCGGGTCCTGTGCAGCTGG - Exonic
1124048946 15:26177221-26177243 CGTCATGGCCAGAGTGCAGCCGG + Intergenic
1124069278 15:26376490-26376512 CTTTCTGTGCAGTGAGCAGCTGG - Intergenic
1124070620 15:26389596-26389618 TCTACTAGGCAGTGTGCAGTAGG - Intergenic
1124216648 15:27812979-27813001 CCTCCTGGGGAGGGGGCAGAAGG - Intronic
1124493322 15:30171714-30171736 CCCCCTGGGCTGAGAGCAGCTGG - Intergenic
1124750212 15:32366611-32366633 CCCCCTGGGCTGAGAGCAGCTGG + Intergenic
1125502834 15:40250153-40250175 CCTCCTGGGCAGGGCTGAGCTGG + Intronic
1126937920 15:53731745-53731767 CCTCCTGGGCAGCCAGCACCAGG + Intronic
1127960464 15:63886795-63886817 CCTACTGGGGAGTGGGCAGAAGG - Intergenic
1128555642 15:68629963-68629985 CCTCCAGGGCAGGGTGCCTCTGG - Intronic
1128868429 15:71134228-71134250 CCTCATAGGCAGGGAGCAGCTGG + Intronic
1128979357 15:72175318-72175340 CCCTCTGGGCAGTGTGCATGTGG - Intronic
1129111815 15:73341575-73341597 CATGCTAGGCAGTGTGGAGCCGG + Intronic
1130956445 15:88630371-88630393 CTTCCTGGGCAGGGTGGGGCAGG + Exonic
1131022070 15:89107172-89107194 CATCCTTGGCAGTGCACAGCTGG - Intronic
1131061389 15:89406789-89406811 CCTCCTGGTCAATCTGCATCGGG + Intergenic
1131300947 15:91199361-91199383 CCTCCAGGCCAGTGTGCTCCGGG + Intronic
1132736064 16:1386818-1386840 CCTCCTGGGCCGTGGGCTGAGGG - Intronic
1133465175 16:6020775-6020797 CCTCCTGGGCGGTGGGGAGATGG - Intronic
1134243569 16:12523467-12523489 CACCCTGGGCAGTGAGCATCGGG - Intronic
1134596092 16:15497121-15497143 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1134673321 16:16071926-16071948 CCTCCTGGGAAGTGTGAGACAGG - Intronic
1135080808 16:19433424-19433446 CCTCCAGGTCATTGTGCTGCAGG - Intronic
1135921333 16:26651380-26651402 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1135927123 16:26705287-26705309 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1135942413 16:26834121-26834143 CCTTCTGTGTAGTGAGCAGCAGG + Intergenic
1135990501 16:27216046-27216068 CCTCCTGGGCTCAGTGCGGCTGG + Intronic
1137591864 16:49698661-49698683 CTTCCTGGGGAATGTGGAGCAGG - Intronic
1137747309 16:50832000-50832022 TCTCCAGGGAAGGGTGCAGCTGG + Intergenic
1138537278 16:57666774-57666796 CCACCTGGGAAGTGGGCAGAGGG - Intergenic
1138879968 16:61001249-61001271 TCTCCTGGAAAATGTGCAGCTGG - Intergenic
1139952307 16:70678368-70678390 CCTGCAGGGCACTGTCCAGCTGG + Exonic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1140709940 16:77668052-77668074 CCTCCTGGGTAGCGAGTAGCTGG - Intergenic
1141102945 16:81211251-81211273 CCCCCTGGGATGTGGGCAGCAGG - Intergenic
1141151205 16:81565725-81565747 CCTCCTGGGTAGGGGGCAGGTGG - Intronic
1142008136 16:87700066-87700088 GCTCCTGGGCCGTGTGCGGGTGG + Intronic
1142030750 16:87837265-87837287 CCTCCAGGGCTGTGGGCTGCAGG - Intronic
1142867887 17:2801948-2801970 CCTCATGGGAGGGGTGCAGCTGG - Intronic
1143059767 17:4189963-4189985 CGTCCTGGGCAGTGGCTAGCGGG - Intronic
1143388710 17:6547547-6547569 CCTCCTGGGGAGCCTGCAGGTGG - Intronic
1143537420 17:7549467-7549489 CCTCCTGGGCAGGCTCCTGCTGG - Exonic
1144779328 17:17799952-17799974 CCCCATGGGCAGTGGGAAGCAGG - Intronic
1145749666 17:27346324-27346346 TCTCCTGGTCCCTGTGCAGCTGG + Intergenic
1145866838 17:28247249-28247271 CCTCCTAGACAGTGTGCTGGAGG - Intergenic
1145906435 17:28518748-28518770 CCTCCTGGAGAGTGAGCATCTGG + Intronic
1146749425 17:35364548-35364570 ACACCTGGGCAGTGGGCACCAGG + Intronic
1147162349 17:38575570-38575592 CTTCCTTGCCAGTGTGCAGAGGG - Intronic
1148792042 17:50178588-50178610 GCTCCGGGGCAGCGTGCAGCAGG - Intergenic
1149993822 17:61396870-61396892 CCCCGCGGGCAGTGGGCAGCAGG - Intergenic
1150959792 17:69900914-69900936 ACTCCTGGGCAGTGCTGAGCAGG - Intergenic
1151204552 17:72496565-72496587 CCTCATGGGTTGTGTGCAGGAGG + Intergenic
1151214654 17:72569354-72569376 CCTCCTGGGCATTGTACCACCGG - Intergenic
1151718272 17:75842572-75842594 CCTGCTGGGCATTGAGCAGGGGG - Exonic
1152292800 17:79449864-79449886 CCTCCTGGCCATTGTTCAGCAGG + Intronic
1152748887 17:82053430-82053452 CCTGCTGTGCAGGCTGCAGCGGG - Intronic
1153446627 18:5180041-5180063 CCTCCTGGGAAGCATGCAGTGGG - Intronic
1153985006 18:10343853-10343875 CCTCCTGGGCACTCTGTGGCAGG + Intergenic
1154332959 18:13444682-13444704 CCTCATGGGCACTGTTCACCTGG - Intronic
1159002472 18:62986694-62986716 CACCCTGGGCAGAGTGCAGTGGG + Intergenic
1160609176 18:80072914-80072936 CCTCCTGGGAGGTGACCAGCAGG - Intronic
1161041024 19:2110866-2110888 CATCCGGGGCAGTCTGCAGGAGG - Exonic
1161129458 19:2579493-2579515 CCTCCAGGGCTGTGTGCCGAGGG - Intronic
1161200503 19:3012129-3012151 CCTCCCGGGTAGTGGGTAGCTGG - Intronic
1161221232 19:3119144-3119166 CCCCTTGGGCTGTGTGCAGTGGG + Intronic
1161646732 19:5457499-5457521 CCTCCTGAGTAGCGAGCAGCTGG - Intergenic
1161718936 19:5892677-5892699 CCTGCTGGGCAGTGTGGACCCGG - Exonic
1162450164 19:10749601-10749623 CCTCCTGGGCTGTGTGGCCCTGG - Intronic
1164788438 19:30956336-30956358 CCTCCTTGGCTGTGTGGGGCTGG + Intergenic
1164987658 19:32660426-32660448 CCTCCTGGGCAGTCCCAAGCTGG - Intronic
1165159133 19:33805633-33805655 CCACCTTGGCAGGGTCCAGCTGG + Intronic
1165233133 19:34399889-34399911 CCTTCTTGGCAGAGTGGAGCTGG + Exonic
1165243129 19:34482529-34482551 CCTCCCGGCCAGGGGGCAGCGGG - Exonic
1167055331 19:47107398-47107420 TCTCCCCGGCAGTGTGCAGTAGG - Intronic
1167515099 19:49918767-49918789 CCTCCTGGGTAGTGAGCACACGG - Intronic
1167569808 19:50280123-50280145 TCACCTGGGCATCGTGCAGCTGG - Exonic
1167685455 19:50953033-50953055 CCTCCTGGGCTCTGGGCACCGGG + Exonic
1202695203 1_KI270712v1_random:118350-118372 CCTTATGGGCAGTGTCCTGCAGG + Intergenic
925741569 2:7009651-7009673 CTTGCTGGGCAGTTTGCTGCAGG + Intronic
925977050 2:9149095-9149117 CAGCCTGGGTTGTGTGCAGCAGG - Intergenic
927188734 2:20501165-20501187 CTTCCTGGGCAGTGTATAGCAGG - Intergenic
928313084 2:30226336-30226358 CCTCCCAGGAAGTGTCCAGCTGG - Intergenic
931153606 2:59602693-59602715 CTTTTTGTGCAGTGTGCAGCAGG + Intergenic
932593238 2:73079617-73079639 CCTCCTGGACAGTGTTCTGGGGG + Intronic
932900647 2:75695850-75695872 CATCCTGGGCAGGATGAAGCAGG + Intronic
934276371 2:91575399-91575421 CCTTATGGGCAGTGTCCTGCAGG + Intergenic
934662183 2:96148841-96148863 CCTCCTGGCCAAGGTGAAGCGGG + Intergenic
935068904 2:99676412-99676434 CTTCCTGGGCAGTGTGACGCTGG - Intronic
935765640 2:106365038-106365060 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
936018150 2:108975093-108975115 CCACCTGGGGCGAGTGCAGCAGG + Intronic
936153275 2:110033086-110033108 CCTCCTGGGCAGTGGAAACCTGG + Intergenic
936191406 2:110338329-110338351 CCTCCTGGGCAGTGGAAACCTGG - Intergenic
936585776 2:113756557-113756579 CCTCCTGGGCCGAGTGGAGTTGG - Exonic
936929336 2:117771313-117771335 CTTCCTGGGTACTGTGCAGTCGG - Intergenic
937394235 2:121520519-121520541 CCTCCTGAGCTCTGTCCAGCTGG + Intronic
937424760 2:121789697-121789719 CCTGCTGGGCTGGTTGCAGCAGG + Intergenic
938324673 2:130390682-130390704 CCTGCTTGGCAGGGAGCAGCTGG - Intergenic
938422210 2:131154690-131154712 CCTGCTGGGCTGTGTTCAGTAGG - Intronic
938540127 2:132278770-132278792 CCTCCTGGGAAGGGTGTGGCTGG - Intergenic
940075372 2:149735668-149735690 CATGCTGGGTAGTGAGCAGCAGG - Intergenic
940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG + Exonic
940596295 2:155796807-155796829 CCTCCTCAGCCGTGTGCAACAGG - Intergenic
941007582 2:160263369-160263391 CCTCATGGGCAGTGGGGAGCTGG - Intronic
942145180 2:173019691-173019713 CATCCTGGGCCTTGTGCAACTGG - Intronic
942545269 2:177056832-177056854 CAGCCTGGGCTGTGGGCAGCTGG - Intergenic
944768781 2:202891259-202891281 CCTCCTGGGCTGGGCGTAGCTGG + Intronic
946057887 2:216917502-216917524 CCCCCTGTGCAGTTTGCAGTGGG - Intergenic
946479484 2:220040447-220040469 TGTCCTGGGCAGTGCGGAGCTGG + Intergenic
946938117 2:224742862-224742884 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
947483130 2:230521628-230521650 CTTTCTGTGCAGTGAGCAGCTGG + Intronic
947524251 2:230868794-230868816 CCTCTTGGCCAGTGGGCATCAGG - Intronic
947538514 2:230957422-230957444 CCTCCTGAGCAGGATGGAGCGGG + Intronic
948643010 2:239387313-239387335 CCTCCTGGCCTGGGTGCACCGGG - Intronic
948866249 2:240776201-240776223 ACTCCTGGCCGGTGTCCAGCTGG - Intronic
1169610486 20:7374352-7374374 CCTCCTGAGGAATGTGCAGTTGG + Intergenic
1170231140 20:14048114-14048136 CTTTCTGTGCAGTGAGCAGCAGG - Intronic
1170890281 20:20369650-20369672 ACACCTGGGCGGCGTGCAGCAGG - Exonic
1171150356 20:22822149-22822171 GCTCCTGGGCTGTCTGCAGCCGG - Intergenic
1172440662 20:34964083-34964105 CCTCCTGTGCAGTGTGTTGAAGG + Intergenic
1174648043 20:52103086-52103108 TCTCCTGGGAAAGGTGCAGCTGG + Intronic
1174708973 20:52685186-52685208 CCTCCATGGCAGAGTGCAGTGGG + Intergenic
1175160312 20:57003324-57003346 CCACCTGGGCTGTGGGCTGCGGG + Intergenic
1175230409 20:57470218-57470240 CCACCTGGGCGTTGTGCATCTGG + Intergenic
1175605339 20:60308075-60308097 CCTTCTTGGCAGTGTGCACCAGG - Intergenic
1175972230 20:62692326-62692348 CCTGCTCTGCAGTGGGCAGCTGG - Intergenic
1176235390 20:64051308-64051330 CCTCCTGGGCAGCTGGCAGGAGG + Intronic
1176296216 21:5074920-5074942 GCTCCTGGTCATTCTGCAGCTGG - Intergenic
1178285265 21:31320621-31320643 CTCACTGGTCAGTGTGCAGCTGG - Intronic
1178473622 21:32917486-32917508 CCTCCTGGGCTCTGAGCAGGGGG - Intergenic
1178790069 21:35691677-35691699 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
1178918576 21:36723449-36723471 CCTCCTGGGCACAGTGCAGCTGG + Intronic
1179860833 21:44187201-44187223 GCTCCTGGTCATTCTGCAGCTGG + Intergenic
1180701949 22:17785944-17785966 GCTCCTGTGCTGTGTGCGGCAGG + Intergenic
1182005838 22:26958884-26958906 CCTCCTGATCAGTGTGCTGGTGG + Intergenic
1182462742 22:30494106-30494128 CCTCCTGGGGAGGGAGAAGCAGG - Intronic
1182475922 22:30576206-30576228 CCTTCTGGGCCGAGTCCAGCAGG + Intergenic
1182683809 22:32105000-32105022 CCTCCAGGGCAGTGAGGAGTAGG + Intronic
1182744039 22:32591853-32591875 CGTCCTGGGCAGAATGGAGCTGG - Intronic
1184035687 22:41917091-41917113 CCTCCAGGGCAGTGGGCAGAGGG - Intergenic
1184264036 22:43337294-43337316 CCTCCCGGGCAGGGGACAGCAGG + Intronic
1184643491 22:45884286-45884308 TCTGCCTGGCAGTGTGCAGCAGG + Intergenic
1184793877 22:46719849-46719871 CCTCCTGGCCAGTGAGCAGGGGG + Intronic
1184846933 22:47093864-47093886 CTTTCTGTGCAGTGAGCAGCAGG - Intronic
1184950787 22:47841276-47841298 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1185113697 22:48919303-48919325 CCTCCTGACGAGGGTGCAGCGGG + Intergenic
1185342233 22:50296825-50296847 CCTCATGTGCCCTGTGCAGCGGG + Intronic
950131709 3:10551855-10551877 CTTCCTGGGCTGTGGGAAGCAGG + Intronic
953982253 3:47418706-47418728 CCTGCTGGGCACTGGGAAGCAGG - Exonic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
954646523 3:52135077-52135099 CTGCCTGGGCACTCTGCAGCAGG - Intronic
956360868 3:68445579-68445601 CCTCCTAGTCAGTTTACAGCTGG - Intronic
957301444 3:78397002-78397024 ACTCTTGGGCAGGGGGCAGCAGG + Intergenic
959050646 3:101521619-101521641 CTTCCTGGGCAGGTTGCTGCAGG + Intergenic
961011385 3:123438521-123438543 TGTCCTGGGCAGGGTGAAGCAGG - Intronic
961652798 3:128425724-128425746 CCTCCTGTCCTGTGGGCAGCAGG + Intergenic
961683298 3:128613251-128613273 CCTCCTGGGGGGTGCGCAGAAGG - Intergenic
961747008 3:129070477-129070499 CTTTCTGTGCAGTGAGCAGCGGG - Intergenic
963843688 3:150133333-150133355 CCTCCAGGGAAGTGAGAAGCAGG + Intergenic
964137640 3:153363235-153363257 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
964767487 3:160192703-160192725 CCACCAGGGCAATGTGCATCTGG - Intergenic
965364675 3:167783979-167784001 CTGCCAGGGCAGTGGGCAGCAGG - Intronic
966668291 3:182497460-182497482 CCTCCTGTGTTGTGTGCAGTAGG - Intergenic
968504386 4:965190-965212 GCACCAGGGCAGTGAGCAGCCGG + Exonic
968739233 4:2319057-2319079 CCTCCTGGGCGGTGTGGGGCTGG - Intronic
968867608 4:3223723-3223745 CCTCCTGGTCAGTGAGAAGCTGG + Intronic
968926457 4:3551050-3551072 CCCCCTGGGCAGAGTGCACCGGG - Intergenic
969386367 4:6851875-6851897 CCTGCTGTGCTGTGTGAAGCTGG - Intronic
969636766 4:8373974-8373996 GCTCCTGGGCAGAGTGAAGCAGG + Intronic
970720351 4:18981001-18981023 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
972045270 4:34657296-34657318 CTTACTGTGCAGTGAGCAGCAGG + Intergenic
972332161 4:38074012-38074034 CCTCTTGGATAGTGTGCTGCTGG + Intronic
972586003 4:40437704-40437726 CCTCCTAGGCAGGGGGCACCAGG - Intronic
972652015 4:41027203-41027225 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
974618437 4:64322363-64322385 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
974682751 4:65184417-65184439 ATTGCTGGGGAGTGTGCAGCAGG + Intergenic
975317509 4:72971713-72971735 CATCCTGGGCAGGATGAAGCAGG - Intergenic
979063393 4:116097083-116097105 CAACCTGGGCAGTGTGAAGATGG - Intergenic
981492397 4:145353442-145353464 CCTCATAGGAAGTGTGCAACAGG - Intergenic
983646173 4:169993671-169993693 CCCCCTGGCCAGTGGGCAGGAGG - Intronic
984030928 4:174603167-174603189 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
984783673 4:183549059-183549081 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985284793 4:188326031-188326053 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985411836 4:189693797-189693819 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985489076 5:168467-168489 CCTCCTGGTCAGTCAGCAGTGGG + Intronic
985628382 5:1001971-1001993 CCCCCTGGGCTGTGGACAGCAGG + Intergenic
988039607 5:25872739-25872761 CCTTCTGTGCGGTGAGCAGCAGG + Intergenic
990331966 5:54736525-54736547 CCTCCTTGGCAGCCTGCAGCTGG + Intergenic
990815030 5:59774807-59774829 CCTCCTGAGTAGTGAGTAGCTGG + Intronic
991633667 5:68681709-68681731 CCTCAGGGGGAGTGGGCAGCTGG - Intergenic
992501246 5:77346392-77346414 CCTGTTTTGCAGTGTGCAGCTGG + Intronic
992508458 5:77410233-77410255 CCCCATGGGCAGTGTGCCCCTGG + Intronic
995796307 5:115945231-115945253 CATCCTGGGCACTGTGCATCTGG + Intergenic
997551004 5:134753309-134753331 CCTCCTGAGTAGTGAGTAGCTGG + Intergenic
997598997 5:135126790-135126812 TTTCCTGGGCAGTGGGCGGCGGG + Intronic
997878840 5:137572135-137572157 CCTGCAGTGCAGTCTGCAGCGGG - Intronic
998024598 5:138804475-138804497 CTTGCTGGGCAGTGGGAAGCAGG - Intronic
998123640 5:139600396-139600418 CCTCCAGCACAGTGTTCAGCAGG + Exonic
998213487 5:140219383-140219405 AATCGTGGGCAGTGTGCTGCAGG + Intronic
998483977 5:142485800-142485822 CCACCTGGGCCAGGTGCAGCAGG - Intergenic
999199346 5:149804912-149804934 CCTCAGGGGCCGAGTGCAGCTGG - Intronic
1001025158 5:168217961-168217983 CATCATGGGCAATGAGCAGCTGG + Intronic
1002106960 5:176884293-176884315 CCTCCTGGGGAGTAGGGAGCGGG - Intronic
1002304249 5:178274010-178274032 CCTGCAGGGCAGTGTGCTGTGGG - Intronic
1002799279 6:505638-505660 CCTCCTGGGCACTGTGTCCCCGG + Intronic
1004567583 6:16813245-16813267 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1005840442 6:29741784-29741806 CCACCAGGGCAGTGCACAGCTGG - Intergenic
1005960743 6:30691051-30691073 CCTCCTGGGCTGGATTCAGCCGG - Exonic
1007144949 6:39619542-39619564 ACTTCTGGAGAGTGTGCAGCTGG - Intronic
1007486750 6:42185722-42185744 CCTCCTCGGGTGTGAGCAGCTGG + Exonic
1011030622 6:82918995-82919017 CCTCCTGTGCAGAGAGTAGCAGG + Intronic
1011834317 6:91411680-91411702 TCACCTGGGTAGGGTGCAGCTGG + Intergenic
1012464832 6:99505549-99505571 CCTCCTGGGCTGGGAGTAGCTGG - Intronic
1013160424 6:107538573-107538595 CCTGCAGGCCAGGGTGCAGCTGG - Intronic
1013334237 6:109139208-109139230 CATCCTGGGCAGGATGGAGCTGG + Intronic
1014495065 6:122111280-122111302 CTTCCTGTGCTGTGAGCAGCAGG + Intergenic
1014960241 6:127674443-127674465 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1015587397 6:134789817-134789839 CCACCTGGGCAGTCTGGAGGAGG + Intergenic
1018924028 6:168194326-168194348 AGCCCTGGGCAGTCTGCAGCAGG + Intergenic
1019289101 7:241267-241289 GCTCCCGGGCAGAGGGCAGCAGG - Intronic
1019293393 7:261257-261279 GCTCCTGGGCCGTGTGACGCTGG - Intergenic
1019333550 7:471952-471974 CTTCCTGGGCAGTCAGCTGCAGG - Intergenic
1019598244 7:1868413-1868435 CCTCCCGGGCTGCGTGCTGCTGG + Intronic
1019963963 7:4484003-4484025 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1020017599 7:4840493-4840515 CTTCCTGAGCAGTGTGCTGCCGG - Intronic
1021556325 7:21922420-21922442 CCTGCAGGGCAGTGATCAGCTGG - Intronic
1022018507 7:26376458-26376480 CCTCGCGGGCCGTCTGCAGCAGG - Intergenic
1022271973 7:28817300-28817322 CCTCCTGCTCAGTGGGCATCAGG + Intronic
1023814383 7:43938455-43938477 CCTCCTGCCCAGTGTTCTGCAGG + Exonic
1024062519 7:45709614-45709636 CATCCTGGGCAGTGGGGAGCTGG - Intronic
1024654786 7:51442500-51442522 CCTTCTGTGCAGGGAGCAGCAGG - Intergenic
1024961494 7:54981440-54981462 CCTCCTGGGCTGGCTGCTGCAGG - Intergenic
1025913885 7:65850259-65850281 CCTCTTGCTCAGTGTGCATCAGG + Intergenic
1026849962 7:73718341-73718363 CCTCCTGGGCATCCTGGAGCCGG - Intronic
1029021844 7:97372325-97372347 CCTTCTGTGCAGTGAGCAGCAGG + Intergenic
1031588685 7:123563876-123563898 CATCATGGGCAGTGTGAAGAAGG + Intergenic
1034319396 7:150165711-150165733 CCTCTTGTGCAGTGCACAGCTGG + Intergenic
1034473483 7:151269224-151269246 CCTGCTGGGCAGAGTGGAGTGGG + Intronic
1034480808 7:151319317-151319339 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1034773362 7:153801500-153801522 CCTCTTGTGCAGTGCACAGCTGG - Intergenic
1034999148 7:155597593-155597615 CCTCCTCAGCACTGAGCAGCTGG + Intergenic
1035361532 7:158316731-158316753 CCTCCTGGGCGGTGAGGAGCTGG - Intronic
1035427210 7:158787039-158787061 CCATATGGGCAGTGTGCACCTGG + Intronic
1035596602 8:863135-863157 CCTCCTTGGCCGTGAGCAACAGG - Intergenic
1035735307 8:1883076-1883098 CCTCCTGGGCATGGTCCCGCAGG + Intronic
1035921817 8:3685390-3685412 CATTCTGTGCAGTGAGCAGCAGG - Intronic
1037274521 8:17163296-17163318 CAGCCTGGGCAGTGTCCAGCTGG + Intronic
1037974934 8:23202321-23202343 CCCCCTGGGCTGTGTGCTCCTGG - Intronic
1039403432 8:37292754-37292776 ATTCCTGGGCAGAGTGGAGCTGG - Intergenic
1039586600 8:38712457-38712479 CCTCCTGGGTAGGGTGGAGCCGG + Intergenic
1039661916 8:39477288-39477310 GCTGCAGGGCATTGTGCAGCAGG - Intergenic
1039823609 8:41155086-41155108 CCTTCTGGGCAATTTGCAGCTGG - Intergenic
1040466770 8:47702732-47702754 ACTCATGGGCAATGTGCACCGGG + Intronic
1040781308 8:51112960-51112982 CCTCTTGGGCAGTGCAAAGCAGG + Intergenic
1040791923 8:51240743-51240765 TATTCTGGGCAGTATGCAGCAGG + Intergenic
1041005411 8:53493023-53493045 CCTGCTGGCCTGAGTGCAGCTGG + Intergenic
1042182226 8:66102294-66102316 TCTCCTGGGCACTGTGCTACTGG + Intergenic
1044014007 8:87028463-87028485 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1047133668 8:122051584-122051606 CTTGCTGGGCTGTGTGCAGGGGG - Intergenic
1048268092 8:133005206-133005228 CCTCCTGCGCAGTGTGCCTGCGG - Intronic
1048551543 8:135437938-135437960 CATCCTGGGCAGTCTACAGCTGG + Intergenic
1048979961 8:139697947-139697969 CCTCCTTGGTAATGTCCAGCAGG - Intronic
1049099511 8:140568968-140568990 CCGCTTGGGCAGTGTGCGGCAGG - Intronic
1049220904 8:141428375-141428397 CCCCCTGGGCAGTGGGCAGATGG - Intronic
1049428739 8:142549541-142549563 CCTCCCAGGCGGTGAGCAGCTGG - Intergenic
1049549132 8:143248538-143248560 CCTCATGGGCAGGGCGGAGCTGG - Intronic
1049684422 8:143933664-143933686 CCTCCTGGGCAATCAGCAGTGGG + Intronic
1049811936 8:144579551-144579573 CCTCCTGCCCACTCTGCAGCAGG + Intronic
1050592037 9:7171000-7171022 CATCCTGGGTAGCATGCAGCCGG + Intergenic
1051094699 9:13453108-13453130 ACTCCAGAGCAGTGTGCATCTGG - Intergenic
1053801382 9:41766432-41766454 CCCCCTGGGCAGAGTGCACCGGG - Intergenic
1054143818 9:61548391-61548413 CCCCCTGGGCAGAGTGCACCGGG + Intergenic
1054189813 9:61978586-61978608 CCCCCTGGGCAGAGTGCACCGGG - Intergenic
1054463594 9:65479730-65479752 CCCCCTGGGCAGAGTGCACTGGG + Intergenic
1054648701 9:67610006-67610028 CCCCCTGGGCAGAGTGCACCGGG + Intergenic
1055131938 9:72785705-72785727 CATCCTGGGCAGGGTGAAGTGGG + Intronic
1055189866 9:73504926-73504948 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1057395787 9:94678851-94678873 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1059049579 9:110909257-110909279 CTTTCTGTGCAGTGGGCAGCAGG + Intronic
1059407321 9:114109222-114109244 CCTCCTGTGTAATGTGCTGCTGG - Intergenic
1059978630 9:119744802-119744824 TGTCCTGGGCATTGTGCAGGGGG - Intergenic
1059985316 9:119815248-119815270 CCTCCTGGTCAGTGTGGACTGGG + Intergenic
1060755334 9:126208412-126208434 CCTCCTGGGCATGGGGCAGGGGG - Intergenic
1060968926 9:127727038-127727060 CCACCTGGCCAGGCTGCAGCTGG + Exonic
1061293382 9:129665120-129665142 CCTCCTGGGGGGTGGGCACCGGG + Intergenic
1061388679 9:130305308-130305330 CCTATTGGGCAGGGTGCAGTGGG - Intronic
1061861054 9:133469027-133469049 CCACCTGGGCACTGAGCAGAGGG + Exonic
1062140830 9:134957934-134957956 GCACCTTGCCAGTGTGCAGCAGG - Intergenic
1062547833 9:137071520-137071542 CCTCCTGGGCAGGCCTCAGCTGG + Intergenic
1203670760 Un_KI270755v1:9184-9206 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1186050723 X:5592089-5592111 CATCCTGGGCAGGATGGAGCAGG - Intergenic
1189991267 X:46597438-46597460 CCTTCTGGGTAGTGTGTAGGAGG - Intronic
1191870051 X:65738230-65738252 CCTCTTGGCAAGTATGCAGCTGG - Intronic
1196294946 X:113986531-113986553 CCTTCTGTGCAATGAGCAGCAGG + Intergenic
1196872386 X:120125317-120125339 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1199706061 X:150426414-150426436 CCTCCTGGTCTGTATTCAGCTGG + Intronic
1199864220 X:151828490-151828512 TTTCCTGGGCAGTCTGCAACAGG - Intergenic
1200242906 X:154507107-154507129 CCTGCTGGGGCGTGAGCAGCTGG + Intronic
1200982345 Y:9273718-9273740 CCTGCTGGGCAGTGTGGGGCTGG - Intergenic
1202128061 Y:21586012-21586034 CCTGCTGGGCAGTGTGGGGCTGG + Intergenic