ID: 940245936

View in Genome Browser
Species Human (GRCh38)
Location 2:151616145-151616167
Sequence ATGAACAGCTTCACTTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940245936 Original CRISPR ATGAACAGCTTCACTTTTTA TGG (reversed) Intronic
902463144 1:16594782-16594804 AGGAACACTTTCCCTTTTTAGGG + Intronic
903158369 1:21465944-21465966 AGGAACACTTTCCCTTTTTAGGG - Intronic
903199974 1:21728349-21728371 ATTAACAGCTTCCCATTTTTAGG + Intronic
906115107 1:43351411-43351433 ATCCACAGTTTCACTTTTTGTGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
912438429 1:109679168-109679190 AAGAACACCTTCACATTTTCTGG + Intronic
913991243 1:143614174-143614196 AGGAACACTTTCCCTTTTTAGGG + Intergenic
916356678 1:163917450-163917472 ATGAGCTGCTTCACTCTCTATGG + Intergenic
917106164 1:171494168-171494190 CAGAACAGCTGTACTTTTTAAGG + Intronic
917155848 1:171997891-171997913 ATGAACATTTTCATGTTTTAGGG + Intronic
918952906 1:191162877-191162899 ATATTCAGCTTCATTTTTTATGG + Intergenic
919015206 1:192024716-192024738 ATGAACATACTCTCTTTTTAGGG + Intergenic
919466484 1:197926533-197926555 ATGTAAAGCTACACTTTTAAAGG - Intronic
920406801 1:205720926-205720948 ATGATCTCCTTCCCTTTTTATGG - Intronic
920558262 1:206920156-206920178 CTGGCCACCTTCACTTTTTATGG - Intronic
921854871 1:219971015-219971037 ATGTAAAGCTTTAATTTTTATGG - Intronic
1063581217 10:7309413-7309435 AAGCACAGCTTCACTTTTCACGG - Intronic
1064514127 10:16127514-16127536 ATGAACTCATTCATTTTTTATGG + Intergenic
1064804114 10:19111298-19111320 ATGAGCATTTTCAATTTTTAAGG + Intronic
1064849893 10:19698860-19698882 ATGAACTCATTCATTTTTTATGG - Intronic
1065154383 10:22854405-22854427 ATCTACAGCTTTACTTTTTGTGG - Intergenic
1065878143 10:30014882-30014904 AAGAACAGATTCATGTTTTAGGG + Exonic
1066036658 10:31495457-31495479 TTAAACAGCTTTACTTTTCAAGG + Intronic
1066706637 10:38186968-38186990 ATAAATAGCTACACTTTTTCTGG - Intergenic
1066785317 10:38997230-38997252 ATAAATAGCTGCACTTTTTCTGG - Intergenic
1067552591 10:47246115-47246137 CTGCACAGCTTCAGTTTTTTGGG - Intergenic
1068454955 10:57242296-57242318 CTGTATAGATTCACTTTTTATGG + Intergenic
1068494329 10:57766521-57766543 ATGAAGAACTCCACTTTATAGGG - Intergenic
1068615028 10:59104756-59104778 ATGAAGAGCTTAACCTTTTTTGG + Intergenic
1070120971 10:73576559-73576581 ATGAACAGCTTTACTTTCAGGGG + Intronic
1071094716 10:81959792-81959814 ATGCATAGTTTTACTTTTTATGG + Intronic
1071405101 10:85322417-85322439 ATGAACATCTTAACTCTTTGGGG - Intergenic
1072279953 10:93856679-93856701 ATTCACAGTTTCACTTTCTATGG + Intergenic
1072562914 10:96592837-96592859 CCCAACAGCTTCACTTTCTATGG + Intergenic
1072587273 10:96793680-96793702 ATGTACAGATTCTCTTTTTTTGG - Intergenic
1078707228 11:13756086-13756108 TTGAGCAGCTTTACTTTTCATGG - Intergenic
1079583730 11:22098639-22098661 ATGAAAAGCTTGTCTTTATATGG + Intergenic
1080201343 11:29674565-29674587 ATAATCAGCTTCTCTTCTTAGGG - Intergenic
1080961800 11:37168993-37169015 ATGAAAAGCTTCTCTTGATATGG + Intergenic
1081519265 11:43865926-43865948 ATGACCAACTTCAGTCTTTATGG - Intergenic
1082740421 11:56904840-56904862 ATGCACATCTTCATTTTTCAAGG - Intergenic
1085161219 11:74347863-74347885 TTGAACAGCTTCACTCTGAATGG + Intronic
1085420096 11:76349871-76349893 ATAAACAGCTTCACAATTCAAGG - Intergenic
1086229475 11:84550938-84550960 ATGAACAGCTGTCCTTTCTATGG + Intronic
1086781967 11:90918195-90918217 ATGTACAGATTAACTTTTTTTGG + Intergenic
1091367483 11:135034435-135034457 AGGCACAGTTTAACTTTTTATGG + Intergenic
1092571252 12:9724229-9724251 ATAAACACTTTCACTTTTTTTGG + Intronic
1092819327 12:12338623-12338645 AGGAAAAACTTCACTTATTATGG + Intronic
1092944219 12:13438201-13438223 ATGAACATCTTCAATTTTACTGG - Intergenic
1093880527 12:24398955-24398977 ATCAACAGCTTCACTATACATGG + Intergenic
1094263693 12:28529860-28529882 AAGAATAACTTCAATTTTTATGG - Intronic
1095043407 12:37470314-37470336 ATGAAGAGGTTAATTTTTTAGGG + Intergenic
1096336226 12:50758765-50758787 GTGAACAGATTTACTTTTTCTGG + Intergenic
1098562006 12:71885132-71885154 ATGAACAGCTTAGTTTTTTCTGG + Intronic
1101794959 12:107964491-107964513 ATGGGCAGCTGCACTTCTTATGG - Intergenic
1105545634 13:21348589-21348611 ATGAGCACCTTCACTTCTGAGGG - Intergenic
1108194053 13:47973756-47973778 ATGAACACATTCTTTTTTTATGG - Intronic
1108391664 13:49953197-49953219 ATACACAGCTTCACCTTTTCAGG + Intergenic
1109181375 13:59218050-59218072 TTGAACAGTTTCACATTTTCAGG - Intergenic
1109726236 13:66345124-66345146 ATGAACAGCTGCATAATTTAAGG + Intronic
1110194399 13:72770129-72770151 AGGAACAGCTTCAATTACTAGGG + Intronic
1110383069 13:74876641-74876663 ATTAAAACCTTCAGTTTTTAAGG - Intergenic
1110667892 13:78139096-78139118 ATTAGCAGCTTCATTTTTTTTGG + Intergenic
1111829921 13:93315289-93315311 ATGATCATATTCATTTTTTATGG - Intronic
1111854225 13:93616361-93616383 ATGAACAACTTCCCTTTGAATGG - Intronic
1117111460 14:52460495-52460517 ATGAACAGGTTAATTTATTATGG - Intronic
1118934494 14:70274497-70274519 ATGAATTGCTGCACTTTCTAGGG + Intergenic
1119129331 14:72157024-72157046 AAGAACAGCTTCACTTTTCCAGG - Intronic
1119164169 14:72478668-72478690 ATGCCCAGATTCACTTTATAGGG + Intronic
1119277580 14:73373113-73373135 ATGGAAAGGTTCATTTTTTATGG - Intronic
1119969556 14:78954452-78954474 ATGAGAAGCTTCAGTTTTTTGGG + Intronic
1202941952 14_KI270725v1_random:157925-157947 ATGAAGAGGTTAATTTTTTAGGG + Intergenic
1123397709 15:19954020-19954042 ATGAACTCATTCATTTTTTATGG - Intergenic
1123967424 15:25473099-25473121 ATGAACAGAGCTACTTTTTATGG + Intergenic
1124560424 15:30768918-30768940 TTGAACAACTTGACATTTTAGGG + Intronic
1124670789 15:31636523-31636545 TTGAACAACTTGACATTTTAGGG - Intronic
1125065523 15:35480824-35480846 AGGAAGAGCATCTCTTTTTATGG + Intronic
1126291502 15:47085539-47085561 ATGAAGAGGTTAATTTTTTACGG - Intergenic
1127307466 15:57722029-57722051 ATTAACATCTTCAGATTTTAGGG + Intronic
1127333813 15:57964250-57964272 TTGAACAACTTCACTTCTTTGGG + Intronic
1129307911 15:74681877-74681899 TTGACCAGCTTTTCTTTTTATGG - Intronic
1131008316 15:88996579-88996601 ATGAACTCATTCATTTTTTATGG + Intergenic
1140830733 16:78748343-78748365 TGGAAGTGCTTCACTTTTTATGG + Intronic
1142917879 17:3157280-3157302 ATAAAAAGCTTGACTTTTCAGGG - Intergenic
1143747917 17:9006913-9006935 GTGAACAGCTTCTCTTCTTAGGG - Intergenic
1144041905 17:11419665-11419687 ATGTACAGCTTACCTTTTTTGGG - Intronic
1146372110 17:32271433-32271455 CTGAAAAGCTTCCCTTTTTCGGG + Intronic
1151769664 17:76151945-76151967 AGCTACAGCTTCACTTTTAAAGG + Intronic
1151929171 17:77220459-77220481 TTCAACAGCATCACTTTTGAAGG - Intergenic
1154298851 18:13175252-13175274 ATGAACAGTGTCACTCTCTAAGG + Intergenic
1154378075 18:13825271-13825293 CAGGACAGTTTCACTTTTTATGG - Intronic
1155449166 18:25945544-25945566 ATAAATAGCTTCACTTTTTTTGG - Intergenic
1156046155 18:32879786-32879808 ATGAACTGGGTCACTTTTAATGG + Intergenic
1156333633 18:36149020-36149042 ATATACAACTTCACTTTTTCAGG + Intronic
1156882991 18:42102988-42103010 AAAAACAACTTCACTTTTTCTGG - Intergenic
1157244187 18:46039096-46039118 ATGAACAGGTTCTATTTGTAAGG - Intronic
1160925341 19:1542127-1542149 ATTAATAGCCTCACTTTTTTGGG + Intergenic
1161518342 19:4709753-4709775 TTGCACAGTTTCACTTTTGAAGG - Intronic
1162120222 19:8460951-8460973 TGGAACTGCTTTACTTTTTAAGG + Intronic
1166590106 19:43989952-43989974 ATGAAAACCATCACTTTTCAAGG - Intronic
1202678805 1_KI270711v1_random:32215-32237 AGGAACACTTTCCCTTTTTAGGG + Intergenic
926287823 2:11504349-11504371 ATCCACAGTTTCACTTTTCATGG - Intergenic
926427518 2:12752836-12752858 AGGAATAGCTACACTTTTCAAGG - Intergenic
927895254 2:26777542-26777564 ATGCACTGCTTCACTCATTAAGG - Intronic
930749695 2:54922304-54922326 ATGTTCAACATCACTTTTTAGGG + Intronic
931472426 2:62552388-62552410 CTGAACATCTTCACTCTTGATGG + Intergenic
937102357 2:119281559-119281581 AAAAACAGTTTCTCTTTTTAAGG + Intergenic
940245936 2:151616145-151616167 ATGAACAGCTTCACTTTTTATGG - Intronic
941576973 2:167245066-167245088 CTGAATATCTTCAGTTTTTAAGG - Exonic
943709798 2:191078693-191078715 ATGAGCAGTTTCTCTTTTTCTGG - Intronic
945204317 2:207315579-207315601 GTGTACAGCATCACTTTTGAAGG + Intergenic
945438504 2:209849108-209849130 ATCAACAACTTCTGTTTTTATGG - Intronic
945477453 2:210301739-210301761 GTGAAAAGGTTGACTTTTTAGGG + Intronic
945529057 2:210927153-210927175 ATGTACAGTTTGACTTCTTATGG + Intergenic
945705710 2:213228752-213228774 ATGAGCAGTATCACATTTTATGG + Intergenic
946976611 2:225159989-225160011 ATGAACTGATTTACATTTTAAGG - Intergenic
948228941 2:236335610-236335632 ATCAATAGCTTCATTTTTAAAGG + Intronic
1169332727 20:4729527-4729549 ATGACCAGTTTCAGTTTTTCTGG + Intergenic
1169606424 20:7324792-7324814 TTAAACAGCATGACTTTTTAAGG + Intergenic
1171537866 20:25913071-25913093 ATGAAGAGGTTAACTTTTTAGGG + Intergenic
1171803323 20:29648732-29648754 ATGAAGAGGTTAATTTTTTAGGG - Intergenic
1172583608 20:36066755-36066777 ATGAACAGCTTCACTCCCAAGGG + Intergenic
1172741450 20:37171253-37171275 ATGAACAGCTACCATTTATAAGG - Intronic
1173435997 20:43032787-43032809 AATAAAGGCTTCACTTTTTACGG - Intronic
1174634110 20:51984118-51984140 AAGAACAGTTTCACTTTTTTAGG + Intergenic
1174677084 20:52368658-52368680 AATAATAGCTTCTCTTTTTAAGG - Intergenic
1174936493 20:54875959-54875981 ATGAACTCATTCATTTTTTATGG + Intergenic
1176581216 21:8529009-8529031 ATGAAGAGGTTAATTTTTTAGGG - Intergenic
1176940500 21:14918356-14918378 ATGAATAGCTTTGCTTTATAAGG - Intergenic
1177290839 21:19109433-19109455 ATGACCAACTTCTCTTTTAAAGG + Intergenic
1177500419 21:21947681-21947703 ATGAACTCATTCATTTTTTATGG + Intergenic
1177531927 21:22371633-22371655 ATGAACTCATTCTCTTTTTATGG + Intergenic
1178523939 21:33309135-33309157 ATGAACAGCTGCACTTTTGTTGG - Intergenic
1180233300 21:46441321-46441343 AGGAACATCTTGACTTTTAATGG + Intronic
1180620113 22:17155702-17155724 ATGTACACCTTCACTTTTTATGG - Intronic
1180785839 22:18547219-18547241 ATGAGCAGCTGCACTGTTGAGGG + Intergenic
1181131123 22:20732944-20732966 ATGAGCAGCTGCACTGTTGAGGG + Intronic
1181159639 22:20951116-20951138 ATGAACAACGCCACTTTTTAAGG - Exonic
1181242764 22:21486773-21486795 ATGAGCAGCTGCACTGTTGAGGG + Intergenic
951296644 3:20944391-20944413 ATGCACGCTTTCACTTTTTAAGG + Intergenic
951910953 3:27749875-27749897 ATGATTAGCTTCACTTTTTGTGG - Intergenic
952627695 3:35426795-35426817 ATGTGCAGCTTCAGATTTTATGG - Intergenic
953458077 3:43059850-43059872 AGGAACAGCATCACTTGATAAGG - Intronic
953596545 3:44319544-44319566 ACGAACAGTTTTACTTTTAATGG + Intronic
955232495 3:57111347-57111369 AATTACAGCTTCACATTTTAGGG + Intronic
955766798 3:62353290-62353312 ATGAAAAGTTACATTTTTTAAGG - Intergenic
956495129 3:69817132-69817154 ATAATCAGGTTCACTTTTAAAGG - Intronic
957371115 3:79295266-79295288 ATGAACTCATTCTCTTTTTATGG - Intronic
957376977 3:79371010-79371032 ATGAACTCATTCTCTTTTTATGG + Intronic
957506846 3:81132876-81132898 TTGAACAGCCTCTCTTTTTCTGG + Intergenic
957636199 3:82789760-82789782 CTGAACACCTTCACTTTTTCCGG + Intergenic
957694325 3:83614721-83614743 ATGAAGAGCTTCCCTCTTTATGG - Intergenic
959240776 3:103790663-103790685 ATGAACAGCATTAATTATTAGGG - Intergenic
959743184 3:109745302-109745324 ATTACCAGCTCCCCTTTTTATGG + Intergenic
959989924 3:112619637-112619659 ATGAATAGCTTGACTTCTTTTGG - Intronic
960304060 3:116039862-116039884 ATGACCAGCTTGTCTCTTTAAGG + Intronic
960360066 3:116700195-116700217 ATGAACTCATTCATTTTTTATGG - Intronic
960661556 3:120065695-120065717 ATGGACATTTTCATTTTTTATGG - Intronic
962544117 3:136414700-136414722 ATCAACAGAGTCACTTTCTATGG + Intronic
962938553 3:140104584-140104606 CTGAACAGCTACACTTTATGGGG - Intronic
963104509 3:141635276-141635298 ATGAACAGCTTCTGTTTTCAAGG + Intergenic
964721826 3:159775055-159775077 ACAAAAAGCTTCAATTTTTATGG + Intronic
964753952 3:160077897-160077919 ATCTGCAGTTTCACTTTTTATGG - Intergenic
965193053 3:165556118-165556140 ATGAACATTTTCACTGTTTCAGG - Intergenic
966327277 3:178771322-178771344 ATGATCAACGTCACTTTTAATGG - Intronic
967062052 3:185881329-185881351 ATCCTCAGTTTCACTTTTTACGG - Intergenic
967360307 3:188623054-188623076 GCTAACATCTTCACTTTTTAAGG + Intronic
967446230 3:189569893-189569915 ATGAAGAGCTTTACTTGATATGG - Intergenic
968397246 4:252691-252713 TTGTACATCTTCATTTTTTATGG + Intergenic
969127593 4:4964195-4964217 AGGATAAGCTTCTCTTTTTATGG - Intergenic
971045520 4:22801333-22801355 CTTAACAGCATCACTCTTTAAGG + Intergenic
971944165 4:33252636-33252658 ATGAACATTTTAACTCTTTAAGG + Intergenic
972923311 4:43970658-43970680 CTGTACAGCTTCACCATTTAAGG - Intergenic
973185511 4:47323233-47323255 ATCAGAAGCTTCTCTTTTTAAGG - Intronic
974381634 4:61147821-61147843 ATGAACAGCTCCACAATTTAGGG + Intergenic
974571114 4:63650008-63650030 ATGAACAACTTTACCTTTCAAGG + Intergenic
975631567 4:76409498-76409520 ATGAACAGGTTCACATTAAAAGG + Intronic
976179822 4:82388449-82388471 AAGGAAAGCATCACTTTTTATGG + Intergenic
976958965 4:90943280-90943302 ATGAACACAATAACTTTTTAAGG - Intronic
977379902 4:96259248-96259270 ATGAACAACTAGACTTTCTATGG + Intergenic
977456458 4:97267691-97267713 TTGGACACTTTCACTTTTTAAGG + Intronic
978119543 4:105061968-105061990 CAGAAAAGCTTCACTTGTTATGG - Intergenic
978193358 4:105942243-105942265 GTGTAATGCTTCACTTTTTAGGG + Intronic
978327065 4:107571210-107571232 ATGAAAAGCAACATTTTTTATGG - Intergenic
979449527 4:120853990-120854012 ATGAGCAGGTTCTCCTTTTATGG - Intronic
980567755 4:134567395-134567417 AGCTACAGCTTCACTTTTTCTGG - Intergenic
984043693 4:174770899-174770921 ATGAACTCTTTCATTTTTTATGG - Intronic
984389739 4:179113736-179113758 ATGAACAGCTCCCCTTTTAATGG + Intergenic
986558099 5:9032060-9032082 ATGAACATTTTCCCTGTTTATGG + Intergenic
988268902 5:28988717-28988739 CTGAAGAGTTTCATTTTTTAAGG - Intergenic
989237320 5:39163949-39163971 ATGAACACTTTCAATTTTTGAGG + Intronic
989510812 5:42285669-42285691 ATGTACATCTACATTTTTTAAGG - Intergenic
992660719 5:78958147-78958169 ATAAACTGCTTCACTTCTTTAGG + Intronic
993249704 5:85504258-85504280 ATGAAAAGCTTCACTTCTACAGG + Intergenic
993578176 5:89627342-89627364 ATGAACCTCATCATTTTTTATGG - Intergenic
993832948 5:92782012-92782034 GTGACTAGCTTCAGTTTTTAGGG - Intergenic
998422089 5:141996985-141997007 ATCCACAGTTTCACTTTCTATGG + Intronic
1000079092 5:157827855-157827877 ATCAACTGCTTCATCTTTTATGG + Intronic
1003405993 6:5827906-5827928 ATGAGCACCTTCACTTCTGAGGG + Intergenic
1004403944 6:15314069-15314091 ATGAACAGCATCACTGTTCATGG - Intronic
1008417009 6:51253280-51253302 AAGAAGAGTATCACTTTTTAAGG - Intergenic
1008594284 6:53025595-53025617 TTAAGCAGCTTCTCTTTTTATGG + Intronic
1009564230 6:65291466-65291488 ATATACAACCTCACTTTTTATGG - Intronic
1010094707 6:72027744-72027766 AACAACAGTTTCAATTTTTATGG + Intronic
1010127928 6:72455579-72455601 CTGAAGTGATTCACTTTTTATGG + Intergenic
1011631234 6:89326732-89326754 ATTAACAGATGTACTTTTTAAGG - Exonic
1012597819 6:101060478-101060500 AGTAATAGCTTCGCTTTTTAGGG + Intergenic
1012601899 6:101109264-101109286 GTGAACAGCTTCCTTTTTCATGG + Intergenic
1012721107 6:102746814-102746836 ATAATCAGCTTCATTTTCTATGG + Intergenic
1012808382 6:103925464-103925486 ATGAACAACTTAACTTTTCTTGG + Intergenic
1013829162 6:114252380-114252402 ATGTATAGCTTCTCTTTTGAGGG - Intronic
1014084576 6:117328518-117328540 ATGAACAGGAACATTTTTTAAGG + Intronic
1014866009 6:126531377-126531399 ATAAACATGTTCACTTTATAGGG - Intergenic
1015227738 6:130877163-130877185 ACTAACAGCTTTTCTTTTTAAGG + Intronic
1015632690 6:135247286-135247308 ATCCACAGTTTCACTTTTTGAGG + Intergenic
1015834250 6:137402989-137403011 TTGTAAAGCTTCCCTTTTTATGG - Intergenic
1016106993 6:140175134-140175156 AAAAAAAGATTCACTTTTTAAGG + Intergenic
1016228971 6:141778244-141778266 TTGAACAGCTTCAGGTTTTAAGG - Intergenic
1016405464 6:143724975-143724997 ATGAACAAGTTCACTTTCTATGG + Intronic
1017311062 6:152978359-152978381 ATGGAGAGCTTCATTTTTTGGGG + Intronic
1018374693 6:163200040-163200062 GTGAGCAGAGTCACTTTTTAGGG - Intronic
1019116305 6:169765294-169765316 ATAAACAGGATCAGTTTTTAAGG + Intronic
1021202906 7:17745436-17745458 TTGTCCAGCTTCAGTTTTTAGGG - Intergenic
1021222635 7:17991357-17991379 ATGTATAGCTTCACCTTTTCAGG + Intergenic
1022683115 7:32568518-32568540 ATGAATATCATCACTGTTTATGG + Intronic
1023145682 7:37148611-37148633 ATAACCAGCTTCAATTTTAAAGG - Intronic
1023687752 7:42753901-42753923 CTGGAGAGCTTGACTTTTTAGGG + Intergenic
1024934194 7:54696511-54696533 ATCGGCAGCTACACTTTTTATGG - Intergenic
1027788627 7:82611993-82612015 ATGAACTCATTCATTTTTTATGG - Intergenic
1028007780 7:85598637-85598659 TTGAACAGCTTCAAGTTTTAAGG + Intergenic
1028133859 7:87206742-87206764 ATTCACAGCTTCACTTTTCTAGG - Intronic
1028355684 7:89903751-89903773 ATAAACATCTTCACTTATAAAGG - Intergenic
1030724745 7:112913645-112913667 ATGAACAGCTAGATTTTGTAGGG - Intronic
1034909137 7:154978484-154978506 AAGAACAGCATGATTTTTTAGGG - Intronic
1035178291 7:157069802-157069824 ATGAATAGCTACACTTATTTTGG - Intergenic
1035415274 7:158678435-158678457 ATGAACAAATTAACATTTTATGG + Intronic
1035641858 8:1190115-1190137 ATAAACAACTGCACTTTGTAGGG + Intergenic
1035671175 8:1418296-1418318 TTAAACAGCTTCACTTTAGATGG + Intergenic
1035944447 8:3945390-3945412 ATGAACGGCTTAACTTTTTTGGG + Intronic
1036538067 8:9671803-9671825 ATCCACAGTTTCACTTTTCAAGG + Intronic
1036980957 8:13469505-13469527 ATGAACAGTTTTGCTTTTAATGG - Intronic
1039351869 8:36772222-36772244 ATCCACAGCTTCACTTTCTGTGG - Intergenic
1039490637 8:37944903-37944925 TTGAAGAGCATCACTTTTAATGG + Intergenic
1040081251 8:43288571-43288593 ATAAACAACTCCACTTTGTAGGG + Intergenic
1040844904 8:51827312-51827334 ATGCACAGTTTCACTTTCCACGG + Intronic
1041331698 8:56733410-56733432 ATTGACAGCTACACTTTTTGTGG - Intergenic
1042789717 8:72590508-72590530 ATGAAAGGATTCACTTTTCACGG - Intronic
1042902028 8:73738694-73738716 TTTAACAGCTTCACTTTTGTTGG - Intronic
1045690230 8:104752807-104752829 ATGAACAATTTCATTTTTTCAGG + Intronic
1046321126 8:112577162-112577184 ATAAAAATCTTCTCTTTTTAAGG - Intronic
1048520200 8:135146811-135146833 TTGACCAGCTAGACTTTTTAAGG + Intergenic
1048892949 8:138964182-138964204 AAAAGCAGCTTCACTTTTCATGG - Intergenic
1050836209 9:10082098-10082120 ATGAAGAGGTTCATTTTGTATGG - Intronic
1054821688 9:69527985-69528007 ATGCACATCTTCATCTTTTAGGG - Intronic
1055596540 9:77870975-77870997 ATGAACATGTGAACTTTTTAGGG + Intronic
1055895649 9:81172129-81172151 CTGAACAGCATTCCTTTTTATGG + Intergenic
1057988121 9:99738371-99738393 ATCGACAGCTCCACTATTTAAGG - Intergenic
1059872202 9:118589922-118589944 CTGAACACCTTGACTTATTATGG - Intergenic
1061567403 9:131451063-131451085 AAGAACAATTTCATTTTTTAAGG + Intronic
1203611234 Un_KI270749v1:7054-7076 ATGAAGAGGTTAATTTTTTAGGG - Intergenic
1186020952 X:5254596-5254618 ATGAAGAGCTTCAATTTGTTTGG + Intergenic
1186589142 X:10910248-10910270 ATGCACAGCTTGATTTTTCACGG - Intergenic
1187251939 X:17606536-17606558 ATCAACAGGGTCATTTTTTATGG - Intronic
1188164960 X:26850900-26850922 AAAAAGTGCTTCACTTTTTATGG - Intergenic
1188253848 X:27935049-27935071 ATGATAAGCTTCATTTATTATGG + Intergenic
1189011758 X:37052882-37052904 ATAAAGAGCTGAACTTTTTATGG - Intergenic
1189036950 X:37503404-37503426 ATAAAGAGCTGAACTTTTTATGG + Intronic
1191632517 X:63337536-63337558 AAAAACAGTTTCAATTTTTATGG - Intergenic
1193794589 X:85857869-85857891 ATTAATGGCTTCACATTTTACGG + Intergenic
1195405425 X:104507912-104507934 AGTAACAGCATCACTTTTTCCGG + Intergenic
1197065615 X:122230505-122230527 ATGAAGAGCTTAAATGTTTATGG + Intergenic
1197528329 X:127590861-127590883 ATGAACCTCATCATTTTTTATGG - Intergenic
1198096019 X:133380361-133380383 AGGAACTGCATCACTTTTTTGGG - Intronic
1198621273 X:138513072-138513094 ATGAAAAGAATCACTATTTATGG + Intergenic
1201622809 Y:15979423-15979445 ATGAACAATTACACCTTTTAAGG + Intergenic