ID: 940253807

View in Genome Browser
Species Human (GRCh38)
Location 2:151708104-151708126
Sequence GATATCCTAGAGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940253807_940253815 30 Left 940253807 2:151708104-151708126 CCTTCCACCTGCTCTAGGATATC No data
Right 940253815 2:151708157-151708179 ACCAAATCTTCCCTTTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940253807 Original CRISPR GATATCCTAGAGCAGGTGGA AGG (reversed) Intronic
No off target data available for this crispr