ID: 940255321

View in Genome Browser
Species Human (GRCh38)
Location 2:151722469-151722491
Sequence TGATAGCAAGAGCTCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940255318_940255321 29 Left 940255318 2:151722417-151722439 CCAAAATTCCGGCAAGTGGGATC No data
Right 940255321 2:151722469-151722491 TGATAGCAAGAGCTCTTTGTGGG No data
940255319_940255321 21 Left 940255319 2:151722425-151722447 CCGGCAAGTGGGATCACTGATTT No data
Right 940255321 2:151722469-151722491 TGATAGCAAGAGCTCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940255321 Original CRISPR TGATAGCAAGAGCTCTTTGT GGG Intronic
No off target data available for this crispr