ID: 940259619

View in Genome Browser
Species Human (GRCh38)
Location 2:151766334-151766356
Sequence CCACATGACCAGGGAGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940259611_940259619 7 Left 940259611 2:151766304-151766326 CCTAGAAAGGTTAGAGTGGCTTC No data
Right 940259619 2:151766334-151766356 CCACATGACCAGGGAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940259619 Original CRISPR CCACATGACCAGGGAGCAGT GGG Intergenic
No off target data available for this crispr