ID: 940270117

View in Genome Browser
Species Human (GRCh38)
Location 2:151881395-151881417
Sequence TGGTCCTGCCGGGGAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940270112_940270117 18 Left 940270112 2:151881354-151881376 CCAGATCTGAAAACGTGTGGGAT No data
Right 940270117 2:151881395-151881417 TGGTCCTGCCGGGGAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940270117 Original CRISPR TGGTCCTGCCGGGGAAAAGA AGG Intronic
No off target data available for this crispr