ID: 940270755

View in Genome Browser
Species Human (GRCh38)
Location 2:151887474-151887496
Sequence TACTTGAGAAGATTCCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940270755_940270756 7 Left 940270755 2:151887474-151887496 CCTTTAGGGAATCTTCTCAAGTA No data
Right 940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940270755 Original CRISPR TACTTGAGAAGATTCCCTAA AGG (reversed) Intronic
No off target data available for this crispr