ID: 940270756

View in Genome Browser
Species Human (GRCh38)
Location 2:151887504-151887526
Sequence CAAAATGCAGATAGTAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940270755_940270756 7 Left 940270755 2:151887474-151887496 CCTTTAGGGAATCTTCTCAAGTA No data
Right 940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG No data
940270754_940270756 8 Left 940270754 2:151887473-151887495 CCCTTTAGGGAATCTTCTCAAGT No data
Right 940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940270756 Original CRISPR CAAAATGCAGATAGTAACAC TGG Intronic
No off target data available for this crispr