ID: 940276594

View in Genome Browser
Species Human (GRCh38)
Location 2:151946683-151946705
Sequence CCAGCAGGGCACAAGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940276581_940276594 28 Left 940276581 2:151946632-151946654 CCAGCAGAGAAAGATCAGAGCTT No data
Right 940276594 2:151946683-151946705 CCAGCAGGGCACAAGGCACCTGG No data
940276586_940276594 -5 Left 940276586 2:151946665-151946687 CCTGAGCACCCCAGGGCTCCAGC No data
Right 940276594 2:151946683-151946705 CCAGCAGGGCACAAGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940276594 Original CRISPR CCAGCAGGGCACAAGGCACC TGG Intronic
No off target data available for this crispr