ID: 940281324

View in Genome Browser
Species Human (GRCh38)
Location 2:151992699-151992721
Sequence TTGCTTCCTGATTGCAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940281324_940281330 12 Left 940281324 2:151992699-151992721 CCACCATTGCAATCAGGAAGCAA No data
Right 940281330 2:151992734-151992756 TTTCTCACCTCATTCCAACTGGG No data
940281324_940281329 11 Left 940281324 2:151992699-151992721 CCACCATTGCAATCAGGAAGCAA No data
Right 940281329 2:151992733-151992755 ATTTCTCACCTCATTCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940281324 Original CRISPR TTGCTTCCTGATTGCAATGG TGG (reversed) Intronic
No off target data available for this crispr