ID: 940282041

View in Genome Browser
Species Human (GRCh38)
Location 2:151998777-151998799
Sequence GAGCCTCTCCCCTGCGTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940282037_940282041 2 Left 940282037 2:151998752-151998774 CCCCCAGAAAATCTATTTTCACA No data
Right 940282041 2:151998777-151998799 GAGCCTCTCCCCTGCGTTCGAGG No data
940282036_940282041 3 Left 940282036 2:151998751-151998773 CCCCCCAGAAAATCTATTTTCAC No data
Right 940282041 2:151998777-151998799 GAGCCTCTCCCCTGCGTTCGAGG No data
940282038_940282041 1 Left 940282038 2:151998753-151998775 CCCCAGAAAATCTATTTTCACAG No data
Right 940282041 2:151998777-151998799 GAGCCTCTCCCCTGCGTTCGAGG No data
940282039_940282041 0 Left 940282039 2:151998754-151998776 CCCAGAAAATCTATTTTCACAGT No data
Right 940282041 2:151998777-151998799 GAGCCTCTCCCCTGCGTTCGAGG No data
940282040_940282041 -1 Left 940282040 2:151998755-151998777 CCAGAAAATCTATTTTCACAGTG No data
Right 940282041 2:151998777-151998799 GAGCCTCTCCCCTGCGTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940282041 Original CRISPR GAGCCTCTCCCCTGCGTTCG AGG Intronic