ID: 940283541

View in Genome Browser
Species Human (GRCh38)
Location 2:152011283-152011305
Sequence CCTCAAAGGAAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940283541_940283547 -4 Left 940283541 2:152011283-152011305 CCCTCCACCTTCTTCCTTTGAGG No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data
940283541_940283550 20 Left 940283541 2:152011283-152011305 CCCTCCACCTTCTTCCTTTGAGG No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940283541 Original CRISPR CCTCAAAGGAAGAAGGTGGA GGG (reversed) Intronic
No off target data available for this crispr