ID: 940283547

View in Genome Browser
Species Human (GRCh38)
Location 2:152011302-152011324
Sequence GAGGTCCTGACCAAGAAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940283544_940283547 -8 Left 940283544 2:152011287-152011309 CCACCTTCTTCCTTTGAGGTCCT No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data
940283541_940283547 -4 Left 940283541 2:152011283-152011305 CCCTCCACCTTCTTCCTTTGAGG No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data
940283538_940283547 4 Left 940283538 2:152011275-152011297 CCCCAGGTCCCTCCACCTTCTTC No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data
940283535_940283547 15 Left 940283535 2:152011264-152011286 CCTCCAGTAACCCCCAGGTCCCT No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data
940283540_940283547 2 Left 940283540 2:152011277-152011299 CCAGGTCCCTCCACCTTCTTCCT No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data
940283537_940283547 5 Left 940283537 2:152011274-152011296 CCCCCAGGTCCCTCCACCTTCTT No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data
940283543_940283547 -5 Left 940283543 2:152011284-152011306 CCTCCACCTTCTTCCTTTGAGGT No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data
940283536_940283547 12 Left 940283536 2:152011267-152011289 CCAGTAACCCCCAGGTCCCTCCA No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data
940283534_940283547 16 Left 940283534 2:152011263-152011285 CCCTCCAGTAACCCCCAGGTCCC No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data
940283539_940283547 3 Left 940283539 2:152011276-152011298 CCCAGGTCCCTCCACCTTCTTCC No data
Right 940283547 2:152011302-152011324 GAGGTCCTGACCAAGAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940283547 Original CRISPR GAGGTCCTGACCAAGAAACA CGG Intronic
No off target data available for this crispr