ID: 940283550

View in Genome Browser
Species Human (GRCh38)
Location 2:152011326-152011348
Sequence GCCTTGATCACTCTGTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940283544_940283550 16 Left 940283544 2:152011287-152011309 CCACCTTCTTCCTTTGAGGTCCT No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data
940283543_940283550 19 Left 940283543 2:152011284-152011306 CCTCCACCTTCTTCCTTTGAGGT No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data
940283548_940283550 -4 Left 940283548 2:152011307-152011329 CCTGACCAAGAAACACGGTGCCT No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data
940283539_940283550 27 Left 940283539 2:152011276-152011298 CCCAGGTCCCTCCACCTTCTTCC No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data
940283540_940283550 26 Left 940283540 2:152011277-152011299 CCAGGTCCCTCCACCTTCTTCCT No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data
940283538_940283550 28 Left 940283538 2:152011275-152011297 CCCCAGGTCCCTCCACCTTCTTC No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data
940283541_940283550 20 Left 940283541 2:152011283-152011305 CCCTCCACCTTCTTCCTTTGAGG No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data
940283549_940283550 -9 Left 940283549 2:152011312-152011334 CCAAGAAACACGGTGCCTTGATC No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data
940283537_940283550 29 Left 940283537 2:152011274-152011296 CCCCCAGGTCCCTCCACCTTCTT No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data
940283546_940283550 6 Left 940283546 2:152011297-152011319 CCTTTGAGGTCCTGACCAAGAAA No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data
940283545_940283550 13 Left 940283545 2:152011290-152011312 CCTTCTTCCTTTGAGGTCCTGAC No data
Right 940283550 2:152011326-152011348 GCCTTGATCACTCTGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940283550 Original CRISPR GCCTTGATCACTCTGTGACC TGG Intronic
No off target data available for this crispr