ID: 940285721

View in Genome Browser
Species Human (GRCh38)
Location 2:152031525-152031547
Sequence CAGCACAACCTGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940285713_940285721 21 Left 940285713 2:152031481-152031503 CCACTGTTGACGGGTGCTGTGTT No data
Right 940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG No data
940285712_940285721 22 Left 940285712 2:152031480-152031502 CCCACTGTTGACGGGTGCTGTGT No data
Right 940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG No data
940285710_940285721 30 Left 940285710 2:152031472-152031494 CCTAATATCCCACTGTTGACGGG No data
Right 940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940285721 Original CRISPR CAGCACAACCTGAGGGAGGA AGG Intronic
No off target data available for this crispr