ID: 940286144

View in Genome Browser
Species Human (GRCh38)
Location 2:152034736-152034758
Sequence TGTTTAAAAGAGCACTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940286144_940286149 -9 Left 940286144 2:152034736-152034758 CCCCCACAGTGCTCTTTTAAACA No data
Right 940286149 2:152034750-152034772 TTTTAAACACACTAACCCCTGGG No data
940286144_940286156 28 Left 940286144 2:152034736-152034758 CCCCCACAGTGCTCTTTTAAACA No data
Right 940286156 2:152034787-152034809 TTATGAGGAAAAGTGTTCCCTGG No data
940286144_940286155 13 Left 940286144 2:152034736-152034758 CCCCCACAGTGCTCTTTTAAACA No data
Right 940286155 2:152034772-152034794 GGTAAGGAAAAAAAATTATGAGG No data
940286144_940286148 -10 Left 940286144 2:152034736-152034758 CCCCCACAGTGCTCTTTTAAACA No data
Right 940286148 2:152034749-152034771 CTTTTAAACACACTAACCCCTGG No data
940286144_940286150 -8 Left 940286144 2:152034736-152034758 CCCCCACAGTGCTCTTTTAAACA No data
Right 940286150 2:152034751-152034773 TTTAAACACACTAACCCCTGGGG No data
940286144_940286151 -3 Left 940286144 2:152034736-152034758 CCCCCACAGTGCTCTTTTAAACA No data
Right 940286151 2:152034756-152034778 ACACACTAACCCCTGGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940286144 Original CRISPR TGTTTAAAAGAGCACTGTGG GGG (reversed) Intronic
No off target data available for this crispr