ID: 940287882

View in Genome Browser
Species Human (GRCh38)
Location 2:152050244-152050266
Sequence CAGTGTGCCAAAAGGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940287882_940287887 16 Left 940287882 2:152050244-152050266 CCTTCCATCCTTTTGGCACACTG No data
Right 940287887 2:152050283-152050305 ATCATCTGCTATTGATGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940287882 Original CRISPR CAGTGTGCCAAAAGGATGGA AGG (reversed) Intronic
No off target data available for this crispr