ID: 940288836

View in Genome Browser
Species Human (GRCh38)
Location 2:152058427-152058449
Sequence CAAAATGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940288834_940288836 3 Left 940288834 2:152058401-152058423 CCTAGAAACTTGTTGAATGGTTT No data
Right 940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940288836 Original CRISPR CAAAATGCTGATAGTGATAT GGG Intronic